SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03524
Pre Gene Modal
BGIBMGA013750
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.422
 

Sequence

CDS
ATGGACGCTGTATTTGCGGAATTTCTCCGGCTTCGCTACCCAAAGCTCACTTCCGAGTTTCAGGCCTTCAAGGCCGATCACACCGCGAGCCCTCTCGTGGACTCCACCGAACTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAAAGCTTCTGCATCGAGCACCGCAGCCTCCGTCGTGCCTGCCGTTCCCGCGTCGCCTATACTGGCAAGTAAAACTGCTGCGTCGTCCGCCGTGGTCACCGTTCCAGCAGCGCGATCATCCGCGGCCTCCGTCGCGCCCTCCAAAACTCCCGCTCGTAGGTCACCTGCGCCCGCCTCCTCGTCCTCCGACTCTGACTCGGAGATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGAATTCACCCTGGTACAAAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGCGAACGCGTCGCGTCCCCGCCCTCAGACTCCCGTTGCGCCTCCAGCCCGTGCCACTCCGTCGCCGCGTCCGGTGGCACAAAAAAAAACCCAGACCCCTCCCCCGGTAATCCTTCAAGAGAAGGCAGCTTGGGATCGAGTTTCCCTGGCCCTTAAGGCCAACAATATCAATTTCACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCGAACACCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCACACGTATACGCTCCAGGAGGAGCGCGAACTCAATGCCGTCATACGTGGCATCCCTAAAGAGTTGGATGCCGAGCTCGTCAAGGCCGACCTTCTCGAACAAGGCCTACCGGTTAACTCCGTACACCGCATGCACACAGGCCGCGGAAGGGAGCCATATAACTGATTTTTAAACGCTTACGGTCTCGCAAATCAACGTGATCAGGTTTCTGACTTTTTGCGTGACCATCAAATTGATATCTTTTTAGTGCAGGAGACCCTACTTAAGCCCGCGCGCCGTGACCCTAAAATCGCGAACTATAACATGGTCAGGAACAACAGGCTCTCTGCTCGTGGTGGTACCGTAATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGGAGCTCTGTCATTCTGGCGGGTGACCTAAATTGTAAACATATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCATTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCAGGGCATCAGCCTGGCTGAATCTGATCCACCATCACTCCCGTTTAGCCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCTCCGCTTCAAATTGTCCGACGATATAGGGAACTCCTTAGAGCTAAAAACGCCTCGATACGCGCCTACGACAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCAACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAAGTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGACGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACAAGTTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGTGTCTGCTCTACAAACGCCTCAGAGACTTCATCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAACCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTTAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCCAGTAGAAATAAGTCCTTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCTCACGGATTTCCTCCCGTATTAGGAGAAGGAATCTCACACCCCCGATTACTCTCTTTACACAATCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCTCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCTCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGAGCTTCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATCCAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCACGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGACGCCTTCAGCTCTAACACTAGGAGCAGGCTTAGGGACTTCGGCTTGAAGTGCAAGCGAGAGCGCGCAACGAGCGACAAAGAGGCACAATCGGCCTCCGCGTTCGGCAGCTTTCGACATCTGTCTCTCTCCTACTTGAGTGAGCGATGCATCCGCGTGGACAGCTGCTATACAACAATACATTTACATGTTTTCGTCAAGTATGAAGTTCAGTGA
Protein
MDAVFAEFLRLRYPKLTSEFQAFKADHTASPLVDSTELAAPASPVPACKASASSTAASVVPAVPASPILASKTAASSAVVTVPAARSSAASVAPSKTPARRSPAPASSSSDSDSEMEVDLAPASSTDEFTLVQKGKKRAAESRAPAAAKISKAANASRPRPQTPVAPPARATPSPRPVAQKKTQTPPPVILQEKAAWDRVSLALKANNINFTNARNLANGIQIKVRTPDDHRALSSYLRKERISFHTYTLQEERELNAVIRGIPKELDAELVKADLLEQGLPVNSVHRMHTGRGREPYNXFLNAYGLANQRDQVSDFLRDHQIDIFLVQETLLKPARRDPKIANYNMVRNNRLSARGGTVIYYRRALHCVPLDPPALEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTQGISLAESDPPSLPFSPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLLRFKLSDDIGNSLELKTPRYAPTTGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSNGISNRVIKLLPVQVIVMLASIFNAAMTNCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYECLLYKRLRDFISSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSSRISSRIRRRNLTPPITLFTQSIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYLMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGASWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRSRLRDFGLKCKRERATSDKEAQSASAFGSFRHLSLSYLSERCIRVDSCYTTIHLHVFVKYEVQ

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
1217
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.00327
Exp number, first 60 AAs:
0.00013
Total prob of N-in:
0.00009
outside
1  -  1217
 
 

Population Genetic Test Statistics

Pi
119.729868
Theta
30.591279
Tajima's D
2.541866
CLR
0.424535
CSRT
0.951702414879256
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号