SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO03506
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.983
 

Sequence

CDS
ATGGATTTCGAATCCGCGTCCAGCCCTCAGCCCGGAACCTCGGATGGTTTCCAAACAGTGACACGTGGAAAGAAGCGTACTCGCGCCGTGGAGTCCCGGAACTCCACGACAAAACAGACGAAATCCGCGTCCGCCTCTCGACCGAAAGTAGTAGTTACACCGGAGTCGGACTCCGCGCGCCGCGTAACCCCACCGCCGCGTCCCAAGCCCGCGCCCGCTCCCAAAGAGGACCGCGAGCTCCGCGTAGTAATACGCGGAGTCCCTAAGGAGCTAGAAATAGACTACATTAAGGAGGATCTGACCGCTCAGGCCCTCCCGATAGTTAGTGTGCACCGGATGCACAGCGGGCGGGGCAAACAGCCCTATAATATGATACTCGTGGCGTTAGAACCCACCCCGGAGGCCAAAAAGAAGATCGCATGTCTCACGACAATTTGCGGCCTATCCGGGATCTCGATCGAAGCCCCCCACAAGCGTGGCACTCCCGGGCAGTGCTACAGGTGCCAACTCTATGGCCACTCGGCGCGTAATTGCCACGCGCGCCCCCGCTGCGTGAAATGCCTCGGCGATCACGCTACGATAGATTGCGTTAGAGATAGGGAAACCGCGACCGAACCTCCCAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCCAGGGCTCCGCGAAAACGCCCAACCCACCCAGCTCCGCGAACCGTCGGCCCAAAGACTTCGGCACCTTCAGTGCCGAAACCCGCCTTCGTGCCGGCTGCAGTTCCCACGGTCTCGGCGTGGAAAAAGCCGCTGCCGTATACGAAGGCGGGAACGGAAACCGCACCCCCGCCCCCGCTCGTGACACGCCCCGCGCCCCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTTCCGTCCCCCGCAACCCTCTGCCGTCAACGACTTCGCGCTCGTGCGTGACTTCGTCACTGCGGTGAACTTCGACCGTCTGCGATCGTTCGCAGACGCGATACGTAGGTCGGTAACCCCCGAACAGCGGCTCGCGGCCGCATTCGATCACATGGACGTCTACGAGTCCGTGTCGCCATTCTATAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTTGAATTCCTCCGCGATAATCTTGTAGATATTCTATTAGTGCAGGAAACCTGTCTGAAGCCCTCGCGTCGCGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTCCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACAAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTTGAAATAGTCGGTCCCCCAACTTCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACGCCGCTCCGCCAATCCTCCCTTACGGCCTGGATTCGAATCCATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATCTCTTCCGCGATCATTAGATCTTCAAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCCTTCAAACCGGATTCAGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAACAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACTACTGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCCGGCTCCGACGGCATCCATAACCGCGCGCTAAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATCTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGAACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATTTACGAACGTCTCCTTAGAAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCAAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTACAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATACCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTAGTCGAAGCAAACTGTCCCTCCACAATAAGGTAACTCTCTACAAAACTTGTATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACTCAGCCCGCACCCACTTGAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCACCATGGTTCCTTAGGAATGTGGATCTCCACGATGACCTGGAGCTCGACTCTCTTAGTAAGTATCTACAGTCGGCATCACTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGTTCGAGACAGCGAGCCGACGAGTCAAGACCTCTCCAGAAGAAGAGGAGAGAGCCGTCGAACAAGAAGAGACTCGCTCCTACGCCCTGCGCCGGTCAAGCCACGAGGACCGTGTGAACGCCATACTTGAAGCCTTCGTTATTTTCCTCGAACCAATCCCAGCACCCGTTCCGCGACAGCCACTGCGGCAATACTCGAGCCACCACGTTTTAACGAGAATTGAAGAAATGGTGCTCACACGGTCCGAGAAGATGAGGTCGTCACGCCTTGACCGGCCCGGCAACGAAGCTGTCTCGGGCTCAACTTTGCAAGACGCACAGCAACGAGCTGTGTCGGCCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCAACCTCCTCCCAGTCAACCGCGCCGCGTTCGGGAGTGACGCAGGGACCGCCACCGATGGCGGCACCCTCCTCCCAAGTGGAAAAGTGTCCGGGAGTGCCGCGGGGCTCACAAGCGATGCCCCCCTCCCGCCAAATATTGCCTACGCAATACTCGCCGGCGTCGCCAACGGGACCGAACAGCGGGGTCTGTCGTCGAGTGGTCAGACCTCCCAGCACCGCGACACCGGCAACAACTTCAGGCGACGCAGCAACGGAGAGCGTCGTATCCGCGAGCCAGAACAGAAAAGAGTCAGCGCTCACGGCCAATCCAATTGTACACGGGTCCCACATCACGGACGCCGCTGCCAAAATCTCGACGACAGAAGAAGGCTCCACACTCCGCGACGGGATGGCGCCACCAGTACGAGGATCTTCAAGAAAGTCGAGTCAACAGTCACAACGGCTGTTGCTTATGGCGCGCCTCAAAGAAGAGCATCTTCGCGCCAAGGAAGAACAAGCCCGACTCCAAGCAGAGCTCGCCGCCGCCCGCATCTCAACATTAGAAACCGAAGCGCTCGTTGAAGAAGAAGAAGATGCGCGCACAACACTCACGGAGGACGAGAACGAGCAATCACAGCGCATCGACACATGGCTCAGTCAGCAACGATCGATCGCGCTACAGGGAGTCGAAGAAAGAGTAATGCAGCCAACACACGGATCACCAGCCACCATCGAGCAACCGCAACTGGAACTTCCCGCACCAATAGAACAGCTGAAGCTACCGGCCCCTGCCGCGGCACCGATTGCCGCACCTGTCGCACCGAAGAGCGACATCGCCGAACTAGCAGCTGCCATCGCGACGGCCGCCCGCCAAGCCAGGCCCGGACCATCGCACCGGTACTACGGGGAGCTTCCAGTGTACAGTGGATCGCATCAAGAATGGCTCTCCTTCAAAGTCGCCTACGCCGAATCAGCGGACAGCTTCAGCGCCGCAGAGAACACTGCGAGACTTCGGCGTACGTTGAGAGGAAGAGCAAGAGAAGCGGTCGAAAACTTGTTGCTGCATTACACCGAGCCCGCCGAGATCATGCGGACTCTAGAATCGCGCTTCGGACGTCCAGAAGCAATCGCCGCAACGGAGCTGGAACGACTGCGCGCGCTGCCACGCTGCACGGACACACCGAGGGACATCTGCGTATTCGCGAATAAGGTGAACAACGTCGTCGCCGCTCTGAGGGCCCTCGACCGCGTACATTATATGTACAACCCGGAGCTCACCAACATCACATCAGAGAAGCTGCCGTCCACTCTACGCCACCGCTGGTTCGAATTCTCAGCGACTCAACCGGCGGGAGAACCGGACCTCGTCAAGCTGTCGCGCTTCCTGCAACGCGAGGCGGACCTGTGCAGCCCATACGCACAGCCGGAACCAGAGACGAGAGTGGAGAACACCAGCGGTCGGCGGAAGATGTTGAACACGCCTCAGAGGACGCACACCACGCAAGCGAAGGAAGAGAGGAAATGCGCAGCATGTCAGAAGCCGGGGCACATCCCACAAGATTGTCCCGAATTCAAGAGAGCAGCCGTCAGCGAGCGCTGGGATACGGCGAAGCGCGAGAATTTGTGTTTCCGGTGCCTACGGTTCCGGTCCCGGGGACACGTGTGTAAAAAGAAAAAGTGCGGCGTCGACAGCTGTGAACGCACGCACCACGAGCTGTTGCATAAGAAGCCAGCATGGCAGAAACCGAAAGAAAAAGAAGAGGCGGTCACCTCGACGTGGGCCGCAAGAAGTGCGACAGCCTACCTAAAGATGGCGCCAATTACTGTTATCGGACCGGCGGGAGAAGCAGATACATGGGCCCTGCTGGACGACGGGTCAACGATCTCGCTGATCGACGAAGACTTCGCGAGACAAGTGGGCGCCAAAGGACCGATCGAACCCCTCTTCATCACTGCCATCGGAGACAACAAGATAGACGCAACACGCTCACGACGCGTCCCGCTGAAGCTATGCGGACGCACGGGGGAACCGCAAGAACTGAACCTACGGACAGTCAACGGCTTAAAATTAACACCACAGCGACTGAACATCGAAGTCCTCGCGTCGTGCCATCACCTCACCGACCTCCGCCATCACTTCAAAACGAGCTACGCCTCGCCGAAGATACTGATCGGCCAAGACAACTGGCACCTGCTGGTGACGGAGGAGATGCGGACGGGACGACGCGATCAGCCAGTGGCGTCTCGTACTCCGCTCGGGTGGGTCGTGCACGGAGCACACCCGGGAGGCAAGAGACAGCGCGTCAACTTCGTGGGACACGCGACGACGGTCGATACGAACATGGACGAAGCCCTCAAGCACTACGTCGCGATCGAGGGACTCACCGTCGCCGCCAAGACGCCGAAGAATGACCCAGACGAGCGCGCGCTGAAGATCCTGCGAGAGACCACTCAACAGCAACCCGACGGCCGCTACGAGACCGCACTGCTGTGGCGTGAGGAGGGCCTGAAGATGCCCAACAATTTCGAAGCCGCGCTAAATCGCCTGACGTCCGTAGAGAAGAAACTGGAGAAGGATCCAAACATGAAAGAGCGCTACAAGCAACGAACAAACGCGCTGGTAGCGAAAGGATACGCCGAAGTAACTCCGTCGACGGGTACGAAGAAGCGAACCCGGTACCTGAAACACTTCGGCGTAACACACCCAATGAAGCAGGAGAAGATTCGCATCGTGCACGACGCCGATGCGAAAAATAGAGGGAAGAAGCCCAAACGACATCCTGCTCACCGACCCGGACCTGCTGCAGTCGCTGCCCGGAGCGATGATGCGCTTCAGGCAGCACGCCGTCGCCGTCTCCGTGGACATCGCGGAGATATTCATACAGATAGGCGTCCGAAGCGAGGACCGCGACGCGCTCCGTACCCGGACGCCGCCGACCTCAAGCTCCACACGTACGTGGACACCAACAAGTACGCCCACGACGCCGCGTTGTACTGGCGCGTGGAGACGCCCGACGGGGAGATGAGGACCTCCCTAGCCAAAGACCGAGTCGCAACCGTGAAGCTAACTTCGATACTGCGTCTCGAGCTACAAGCTGCCGTGATGGGCAGCCGCATGGCCGCGGCTGTCACAGAGGAACACGACAGAAAACCAGACGCGAGAGTGTTCTGGACAGACAGCGCCACCGTATTGACCTGGCTACGAACGGGGTCGAGGTCGTATCGACCGTTCGTCGCTCACCGCATTGCAGCGGTAGAAGAGAACAGCACTGTGGAGGAATGGCGCTGGGTCCCCACAAAGGAAAATGTCGCCGACGACGCCACTAGAGAACTACCCGTCGGCTTTGAAAGAAACCACCGCTGGTTCATAGGCCCGGAATACCTGAGACGGCATCCGGATGATTGGCCCGTACAACGGACTGCAAGAAGGGCAGAAGATACGGGCGAAGAGAAGTGCGCAACGCTCGCCGTGAGCAGAGAGAGCCTCGGCGAAGCGATCCCGGACCCAAGACGCTTCTCCAAGTGGGAGAAGTACCTGCGTGCAACGGGGCGGATACTGCAATTCGTCGACCTATGCCGCAGAAGTCGCGAGCGCACTCATTACAAGAGGACCAGACGGAACCCGCGTTCGGACCCGACGTGGGAGAAGAATAGAAAGAAGACGACTTCGAAGACCCCGCTGAACACACCGCGGACGCCAGAGCAAGCTGTCATTCAATGGAAGACTTTAGACGCCGACACGCTTCGACGCGCCGAGATGCTCATTTGGCAACAGAGCCAGCGGGCGGCCTTCGAGGAAGAGATTTTGACGCTCCAGCGAGGGAAACAGATATCCCCAGCGAGCCGACTGCGAAACTTGTCCGTAACTTACGCGGACGGGATATTGAGAATAAACGGACGCATCGGCAACATTGAGGGAGCTGACGTCATGACCTCACCTCTCGTGCTAGACGGATCCCGACGCGAAACGAGACTGATGATAGACTTCATCCATAGAAAGATGCACCACGCCGGAACCGAAGCTACGATCGCCGAGTGCCGACAGTCGTACTGGGTCTTGCGCCTACGCCCAGTGACACGGAGCGTGATCCACAACTGTCTTCCGTGTCGTATCCGCAAGGACACTCCACCGCGTCCAGCCACAGGCGACCACCCACCGAGCAGACTGGCACACCATCGGCGACCATTTACATACGTGGGCCTCGATTACTTCGGGCCCTATCAAGTTACCACCGGCAGAAGCACCCAGAAGCACTACGTGGCCATCTTCACATGTCTCACTACGCGTGCGGTACATTTAGAACCGGCAGCGAGCCTCAGCACGGACTCAGCAGTGATGGCACTCCGGCGCATGATCGCGCGCCGGGGAGCTCCGACGGAGATATGGAGCGACAACGGCACCAATTTACGGGGTGCCGACAAGGAGCTGCGCCAAGCTTTGGACAAGGCGACTGAGCATGAAGCGAGCTTAAAACTTATCCAATGGCGCTTCATCCCACCGGGCGCGCCTTTCATGGGCGGCGCCTGGGAGAGAATGGTGCGGGCGGTAAAGGCCGCGCTCTCGGCCACGGAACAGCCGAGGCGCCCGACGCCCGAAATATTTCATACTCTGCTAGCAGAGGCAGAGTTCACAGTGAACAGCCGACCTCTCACCCACGTATCGGTGAGCGCCGACGATCCCGACCCTCTGACACCGAACCACTTCCTGCTGGGAGGCCCGGCGCGAGTCCCCGTGCCGGGCAAGTTTGACGACGCCGACCTCATAGGGCGCGCACACTGGCGCGCAGCTCAACGTCTGGCAGATGTGTTCTGGAGTCGCTGGCTCCGGGAGTACCTGCCCGACCTGCAGAACCGGCGGGAGCCCCACAGCCGCGGGCCCGCCCTGAAGATAGGCGACGTCGTGATAATAGCAGACGGAACGCTCCCACGGAACACCTGGCCACGTGGGATCATCCAGGAGGTTTACCCGGGGGCCGACGGCATCACTCGAGTGGTCGACGTACGCACCGCCGGCGGTATATTGCGACGCCCGGCAAAGAAGATCATCGTGCTGCCCACGATGACCGCCGCTCACCAAGGAGGATGCAGCGACGTGAACGACGCTGCACGGCGGGAGGATGTTCGCGACGGACATAAAGAAACATAG
Protein
MDFESASSPQPGTSDGFQTVTRGKKRTRAVESRNSTTKQTKSASASRPKVVVTPESDSARRVTPPPRPKPAPAPKEDRELRVVIRGVPKELEIDYIKEDLTAQALPIVSVHRMHSGRGKQPYNMILVALEPTPEAKKKIACLTTICGLSGISIEAPHKRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATIDCVRDRETATEPPSCVLCLKQGHPANYRGCPRAPRKRPTHPAPRTVGPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKAGTETAPPPPLVTRPAPQPLLAPRPAPAFRPPQPSAVNDFALVRDFVTAVNFDRLRSFADAIRRSVTPEQRLAAAFDHMDVYESVSPFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPPTSTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLADAAPPILPYGLDSNPSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTPSNRIQMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIHNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEANVIGIHKPGKPTNETSSYRPISLLSTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATMGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCSRSKLSLHNKVTLYKTCIRPVMTYASVVFAHSARTHLKSLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSLSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMFETASRRVKTSPEEEERAVEQEETRSYALRRSSHEDRVNAILEAFVIFLEPIPAPVPRQPLRQYSSHHVLTRIEEMVLTRSEKMRSSRLDRPGNEAVSGSTLQDAQQRAVSAAPRSGVTQGPPPMAATSSQSTAPRSGVTQGPPPMAAPSSQVEKCPGVPRGSQAMPPSRQILPTQYSPASPTGPNSGVCRRVVRPPSTATPATTSGDAATESVVSASQNRKESALTANPIVHGSHITDAAAKISTTEEGSTLRDGMAPPVRGSSRKSSQQSQRLLLMARLKEEHLRAKEEQARLQAELAAARISTLETEALVEEEEDARTTLTEDENEQSQRIDTWLSQQRSIALQGVEERVMQPTHGSPATIEQPQLELPAPIEQLKLPAPAAAPIAAPVAPKSDIAELAAAIATAARQARPGPSHRYYGELPVYSGSHQEWLSFKVAYAESADSFSAAENTARLRRTLRGRAREAVENLLLHYTEPAEIMRTLESRFGRPEAIAATELERLRALPRCTDTPRDICVFANKVNNVVAALRALDRVHYMYNPELTNITSEKLPSTLRHRWFEFSATQPAGEPDLVKLSRFLQREADLCSPYAQPEPETRVENTSGRRKMLNTPQRTHTTQAKEERKCAACQKPGHIPQDCPEFKRAAVSERWDTAKRENLCFRCLRFRSRGHVCKKKKCGVDSCERTHHELLHKKPAWQKPKEKEEAVTSTWAARSATAYLKMAPITVIGPAGEADTWALLDDGSTISLIDEDFARQVGAKGPIEPLFITAIGDNKIDATRSRRVPLKLCGRTGEPQELNLRTVNGLKLTPQRLNIEVLASCHHLTDLRHHFKTSYASPKILIGQDNWHLLVTEEMRTGRRDQPVASRTPLGWVVHGAHPGGKRQRVNFVGHATTVDTNMDEALKHYVAIEGLTVAAKTPKNDPDERALKILRETTQQQPDGRYETALLWREEGLKMPNNFEAALNRLTSVEKKLEKDPNMKERYKQRTNALVAKGYAEVTPSTGTKKRTRYLKHFGVTHPMKQEKIRIVHDADAKNRGKKPKRHPAHRPGPAAVAARSDDALQAARRRRLRGHRGDIHTDRRPKRGPRRAPYPDAADLKLHTYVDTNKYAHDAALYWRVETPDGEMRTSLAKDRVATVKLTSILRLELQAAVMGSRMAAAVTEEHDRKPDARVFWTDSATVLTWLRTGSRSYRPFVAHRIAAVEENSTVEEWRWVPTKENVADDATRELPVGFERNHRWFIGPEYLRRHPDDWPVQRTARRAEDTGEEKCATLAVSRESLGEAIPDPRRFSKWEKYLRATGRILQFVDLCRRSRERTHYKRTRRNPRSDPTWEKNRKKTTSKTPLNTPRTPEQAVIQWKTLDADTLRRAEMLIWQQSQRAAFEEEILTLQRGKQISPASRLRNLSVTYADGILRINGRIGNIEGADVMTSPLVLDGSRRETRLMIDFIHRKMHHAGTEATIAECRQSYWVLRLRPVTRSVIHNCLPCRIRKDTPPRPATGDHPPSRLAHHRRPFTYVGLDYFGPYQVTTGRSTQKHYVAIFTCLTTRAVHLEPAASLSTDSAVMALRRMIARRGAPTEIWSDNGTNLRGADKELRQALDKATEHEASLKLIQWRFIPPGAPFMGGAWERMVRAVKAALSATEQPRRPTPEIFHTLLAEAEFTVNSRPLTHVSVSADDPDPLTPNHFLLGGPARVPVPGKFDDADLIGRAHWRAAQRLADVFWSRWLREYLPDLQNRREPHSRGPALKIGDVVIIADGTLPRNTWPRGIIQEVYPGADGITRVVDVRTAGGILRRPAKKIIVLPTMTAAHQGGCSDVNDAARREDVRDGHKET

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00750233,     Score=101

Ontologies

Topology

Length:
3094
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05019
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  3094
 
 

Population Genetic Test Statistics

Pi
13.244829
Theta
115.576837
Tajima's D
0.797401
CLR
13.187136
CSRT
0.602969851507425
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号