SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02984
Pre Gene Modal
BGIBMGA003622
Annotation
putative_Ciliary_dynein_heavy_chain_[Operophtera_brumata]
Full name
Dynein beta chain, ciliary      
Location in the cell
Cytoplasmic   Reliability : 2.392
 

Sequence

CDS
ATGCTGCCTCCAGTACCAACGACAGAAGGACTGGACCCTCTGACCATGCTGACCGATGACACGAACATTGCGATGTGGCAAAACGAAGGACTGCCTTCTGATAGAATGAGTACTGAAAATGCCACAATACTGTCCAACTCAGATCGTTGGCCGCTAATGATTGATCCTCAGTTGCAAGGCGTGAAGTGGATTAAACAGAAATATGGAGATATACTTCGTGTTATAAGACTCGGGCAGAAAGGTTATTTGGATACAATAGAGAAAGCTATTATTAAAGGAGAGACTGTTCTCTTAGAAAACATCGGTGAAACAGTCGACCCTGTACTAGATCCACTGCTCGGACGAAACCTAATTAAGAAGGGAAGAGCTATAAAGATCGGCGACAAGGAAATTGAATACAGTCCAAACTTTAGATTGATTTTACACACGAAATTAGCTAACCCACATTACAAGCCCGAGATGCAAGCTCAAACAACATTGGTCAATTTCACTGTAACGAGAGATGGGCTTGAGGATCAACTTCTGGCCGAAGTGGTGAAAGCTGAAAGACCAGATCTAGAAGAACTCAAAGCGGAGTTAACAAAACAACAGAATCAGTTCAAGATACAGCTGAAGGAGTTGGAAGATGATTTGCTTTCGCGTCTCTCAGCAGCCGGAGAGAATATATTAGGCGATACAGCTTTGGTTGAGAATTTAGAAACCACGAAAAAGACTGCTGCTGATATCGAGAAAAAGGTACTCCTCATGAGCGAAGAAATATCACCAGCAGAACTGGACTTTTTCCTACGTTTTCCAATTAAACCTCATGTCACTAGTCCTGTAGATTTCCTATCTAATCAAAGCTGGGGAGGGATATGTTCTCTGGCTGGTAAAGACGAATTTAGAAACCTGGATCGTGATATTGAAACGTCTCCTAAACGATGGAAGAAGATTGTTGAAATAGAATGTCCTGAAAGAGAAAAATTTCCACAGGTAAATTTTTATGGGCACAGCTGTAAAGTTTCCCCTGGCCGAGGACATTAA
Protein
MLPPVPTTEGLDPLTMLTDDTNIAMWQNEGLPSDRMSTENATILSNSDRWPLMIDPQLQGVKWIKQKYGDILRVIRLGQKGYLDTIEKAIIKGETVLLENIGETVDPVLDPLLGRNLIKKGRAIKIGDKEIEYSPNFRLILHTKLANPHYKPEMQAQTTLVNFTVTRDGLEDQLLAEVVKAERPDLEELKAELTKQQNQFKIQLKELEDDLLSRLSAAGENILGDTALVENLETTKKTAADIEKKVLLMSEEISPAELDFFLRFPIKPHVTSPVDFLSNQSWGGICSLAGKDEFRNLDRDIETSPKRWKKIVEIECPEREKFPQVNFYGHSCKVSPGRGH

Summary

Subunit
Consists of at least two heavy chains (alpha and beta), three intermediate chains and several light chains.
Similarity
Belongs to the dynein heavy chain family.
Keywords
3D-structure   ATP-binding   Cell projection   Cilium   Coiled coil   Cytoplasm   Cytoskeleton   Direct protein sequencing   Dynein   Flagellum   Microtubule   Motor protein   Nucleotide-binding   Repeat  
Feature
chain  Dynein beta chain, ciliary
EMBL
JTDY01000081    KOB78984.1    BABH01007454    BABH01007455    BABH01007456    BABH01007457    + More
AGBW02007827    OWR54500.1    NWSH01001294    PCG71814.1    ODYU01012953    SOQ59508.1    KK855459    PTY22671.1    AAZO01003313    DS235271    EEB14162.1    AJVK01064446    AXCM01000636    PYGN01000422    PSN46658.1    AAAB01008849    EAL41019.3    APCN01005160    GGFL01015101    MBW79279.1    AXCN02001753    GGMS01008884    MBY78087.1    CH964232    EDW81616.1    KRF99495.1    KQ414688    KOC63714.1    CH902617    KPU80296.1    EDV43507.1    CH933806    EDW16045.2    CH916373    EDV94871.1    JRES01001345    KNC23525.1    GGFK01000870    MBW34191.1    AF494076    AAQ06635.1    ADMH02002126    ETN58641.1    ATLV01018849    KE525251    KFB43381.1    KQ434980    KZC13060.1    DS232111    EDS35091.1    AE014297    AAF55834.3    AGB96173.1    CH480853    EDW51630.1    CM000160    KRK03004.1    KRK03001.1    CH477538    EAT39332.1    EDW96208.2    JXUM01075435    KQ562886    KXJ74924.1    KRK03003.1    KRK03002.1    CP012526    ALC46327.1    CH479185    EDW38589.1    CH940652    EDW59661.2    CH954181    EDV48312.1    KQ971307    KYB29781.1    EFA11309.2    OUUW01000007    SPP83382.1    CM000070    EAL29221.2    KRT01415.1    CVRI01000047    CRK98041.1    KQ767877    OAD53287.1    GL447755    EFN86050.1    GL444028    EFN61360.1    KQ982691    KYQ52109.1    KQ981572    KYN39778.1    KZ288199    PBC33642.1    KQ977141    KYN05431.1    GL767121    EFZ14108.1    GGMR01018852    MBY31471.1    GGMR01007858    MBY20477.1    UFQS01001276    UFQT01001276    SSX10081.1    SSX29803.1    GL888084    EGI67861.1    QOIP01000009    RLU18201.1    KK107235    EZA54880.1    LBMM01000571    KMQ98045.1    KQ978644    KYN29472.1    ABLF02030722    ABLF02030734    ABLF02030735    ABLF02030737    ABLF02030738    ADTU01005848    ADTU01005849    KQ435706    KOX80265.1    UFQS01000646    UFQT01000646    SSX05712.1    SSX26071.1    KQ976738    KYM75717.1    ACPB03010549    KB632384    ERL94272.1    HAAF01006872    CCP78696.1    AGCU01026795    AGCU01026796    AGCU01026797    AGCU01026798    AGCU01026799    AGCU01026800    AGCU01026801    AGCU01026802    AGCU01026803    AGCU01026804    AAGJ04100285    APGK01047112    APGK01047113    APGK01047114    APGK01047115    APGK01047116    APGK01047117    APGK01047118    KB741077    ENN74141.1    X59603    D01021   
Pfam
PF08393   DHC_N2        + More
PF12774   AAA_6
PF12781   AAA_9
PF03028   Dynein_heavy
PF12780   AAA_8
PF18198   AAA_lid_11
PF17852   Dynein_AAA_lid
PF18199   Dynein_C
PF12777   MT
PF17857   AAA_lid_1
PF08385   DHC_N1
PF07728   AAA_5
Interpro
IPR035699   AAA_6        + More
IPR041228   Dynein_C       
IPR042228   Dynein_2_C       
IPR041658   AAA_lid_11       
IPR041466   Dynein_AAA5_ext       
IPR003593   AAA+_ATPase       
IPR013594   Dynein_heavy_dom-1       
IPR013602   Dynein_heavy_dom-2       
IPR004273   Dynein_heavy_D6_P-loop       
IPR042219   AAA_lid_11_sf       
IPR026983   DHC_fam       
IPR024317   Dynein_heavy_chain_D4_dom       
IPR024743   Dynein_HC_stalk       
IPR027417   P-loop_NTPase       
IPR042222   Dynein_2_N       
IPR041589   DNAH3_AAA_lid_1       
IPR035706   AAA_9       
IPR011704   ATPase_dyneun-rel_AAA       
IPR009069   Cys_alpha_HP_mot_SF       
IPR036084   Ser_inhib-like_sf       
IPR030443   DNAH9       
SUPFAM
SSF52540   SSF52540        + More
SSF47072   SSF47072       
SSF57567   SSF57567       
Gene 3D
PDB
4RH7     E-value=5.28158e-41,     Score=421

Ontologies

Topology

Subcellular location
Cell projection  
Cilium  
Flagellum  
Cytoplasm  
Cytoskeleton  
Flagellum axoneme  
Length:
340
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00042
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00252
outside
1  -  340
 
 

Population Genetic Test Statistics

Pi
27.351596
Theta
21.341972
Tajima's D
0.095214
CLR
105.151144
CSRT
0.406179691015449
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号