SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02618
Pre Gene Modal
BGIBMGA011313
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.081
 

Sequence

CDS
ATGTCTGGGGGGTCACCTCCCCCCAATATCAGCACACCCGGTCCGTCCCGAAAGGGACATCAGGCAATAGCGGGTTCACCCGCTTTTTGCTCCCTACCTGCTCGCCCGGAACTAGGCACCGGAACGGACGACCGGCCCGGTCCTTCGGGCGCGGCCCGAGGGTCACCGAGGATCGGTCCGGGGGAAAGTTTCTTTCCCTTACCGGCAGATTGCTCGGGGTCCCTTCGGCCGCGCAAGAAGGCGAGGTCCGAGTCCGACCGGAGCTCTTCCGAGGCAAAAGATAAGCGCCCCCGGATAGGACCGTCATCTAAATCCTTAAGCGAGATGGAGGGGGACGAGGCTGAGGACAACGAGGACACAACCTCGTCCGAGGACTCGTCCTCTTACGACAGCGAATCCTCGGGCTCGTCCCACTCCACCTCTAAGAGTGTGGAAAGAACCTCCCCAAAAAAGAAACCAATTCCTAAACCTAGGAGGAGTCTAGGGATGGTGGAGGTCCACCCAGTAAAACAGCTGCGTACTCCTCCTCGGTCCCCTTCTCCAGCCATTTCTCCCATTCCGTCGGTTAGACGTAGGGGTGCCCCCACCTTAAGCAGCACGGTGGGCAATCTAGAATCAACTAGATATATGGACCTTGAGTCTACCGCCTCCCACCCTAAAATTACACCCAATCCCATTCCATCTCCAGTACCTTCCACCTCCTATGCTGCAATAGCAGCAACACAAAAGCCATCGACCACGACTCATAGACCAGAGTTAACCAAGTCCCCTGCTCCAGGAGGGATCCGTGCTAACGAGGCACCCCGCCGCCACCCACCTATTATGGTGGAAGCGCTCCCGAACTGGTCTCGCCACATGGCGGCCATAAGGGAGCGCTTGGGGCGGGTCCCGTCTGTGCGACCCTATGGAACAGGGTTTAGATTTCTGCCCGCGTCGGCAGAAGAATACAGGGTGGTTCAAGCCTACCTCGCGGGGGCCTCCTCCGCGGACAGCGCCGTAAAGTGGTACTGTTATGCGTTAGAGGAGGACATCCCCGCGAGGGTGGCGATTCGAGGCCTGCCCGCTGACACCGACGCGGCAGAAATCATTAACGCCCTAAAGGAGCTGGGGTTCCCGGCCCGCTACGCCCGGTGCATAAGGGCAAAGAGAGGGAGGCCGGGTTGCGTATTTTTCGTAACCCTTGACCACCTCTCCAAGGAAGGCCTCGCCCGCTTGTACGCAGTTGAAGAACTGCTGTACCTGCCGGGGGTGTCAGTTGAGGGATGGCGTCCGAACCGAGGACCGGCGCAGTGCCATCGCTGCCAGGCCTTCGGACACGCCTCCACCAACTGCCACCGAGCGGTCCGCTGTGTGCGATGTGCGGGCGAGCACATCGTGGCGGACTGCCCGAGGCCAAGGGAGGGACCCCTCACCTGCGCCAACTGCGGGAAGGGCCACGCCGCTATTGATAAGCGGTGTGTGGTCTACCGCAGGAGGGCGCGGATGATGGGGGTCGCTATTCCTCCCCCCGTACCGCAAGCAGCGACGCGTGCCAGCCAAGCCCCTACCCCCGCTCCACGTCTCGGTCCACGCCCATCTCTGAAGGGTAAGGGCAAGGGGAAGACTTCTCAACCCCCCACTCTCCCTCCGGTTATAGAGCAACCTGCCACTGTGGAGGCCAACCCAACAGCGGCCACCCTGATGGCAGAAGCAAACCCGCAGCGAAAAGCTATAAAGCCGCGACCTGCCCCTCGTTCCAGTAATAAGGCAGCATTCAACTTACAAGCTGCCTTAACTACAACTACAACAAAAACTCAAAAAAAAAATAAGAAAAAAAAAATAAAGGCCAAAGAAAAAAAAATAAAAAAAGCAATGGAAGAAGCAGCTGCCCTGGGAGAAGGCCAAATTGAGCCAGCTACCGAACCTCCATGCCCAATGGAGACGACAGCCAGCGACCCGCTCCAGAACGATAACATCACTCTGGGCGACTCACAGCCCCCATTACCACCCCGCCCGCAGAGAGAGCGGCGCAGTGGCCGACAGGACACGCAGCCTGCCGGCTTCGCTGCCTGGCTTCTCTCCCTGTGGGAGAAATTGTCCGAGGAGCTGCGCATCATCTATTGGAACCCCGACGGGATAGGGTCCCGGAGGTCGGAACTGATCCGACTCGCCCAGGAGTATGACCCGCAGGTTATCCTCCTGGGCGAGACCAAGCTCAAACCTCGACAAGATTTTAGGATGCCCAACTACTTCGTGTACCGACGGGACGAACTGACCTCCAGCGGGCGCCCGTTCAGGGGCACTGCGGCGCTCGTCAGGAGGGACGTGGTGCACGAGGAGCTTGAGCTACTGACCTTCGCCTCTACCAGAACGGTCGGGGTGAGGGTCCACGTACCGGGGGCCGAATTGCGGATTTATGCCGCGTATCGACCCCCGGGTCCTGATTTTGTCGAGGACGATATTAGACGGGCCTTGAACCATGATCGCCATCCGGCCTTGGTGGTCGGGGACCTCAATGCGAAACATGTCGCTTGGGGCTCCCGAATCATCACGCCGCCCGGAAGGCGATTGTACGAGGATGCCGAAAGGGGGGACTACTGCGTGGTCGGCCCCAACGAACCCACACACGTTCCAACGTTGGCCCGGTACCAACCGGACGTATTGGACGTGTGTGTTCACAAGGGGCTACAGTGCCCTCTAGCGATAGAGGCACTGTACGACCTGAGTACCCCTCACCTACCGATCTTGGTCACGGTGGGTTTGGGGCTCACTCGGGTCGCGACATCCCCTCTCAGGCCTAGGGTCGACTGGCAGTCCTTTACGGGACTGCTGGCCGACCAATCCTTGTTTCAAGACCCGTCTACCCCTGATGAGGTCGACACGGCGGCTTCCCGTCTCGTCGACACCATCAGGGGAGCCCTGGACCAAGTGACGACTCTGGTACCCAGCGGGGGGCCCAGAGCGGAACTCCCGGTGCACCTCAAGACGTTAATTCGTCGGAAGAGGGCACTGAGGAGGCTCTGGGCGACATCTAGGTGTCCCAGGATTAAGCGCGAGCTCAACCGACTTGAGGGTGAGCTGGCGACTAAGATGCGGACTTACCGGGGTGATTCCTGGGAGGGGGGACTGTTGGACGCGTCCGACGACCGTACGATGGCCCCCCTTCACCGCATCTGTCGCCGGCTCACCAACAAGCCTTCCCCCACTTGCCCCTTGGAGGACGAGGGGGGAAGACGGTGTTTTACACCGTTGGCTCGTGCTGAAGTCCTGGCCAACTCGCTGGAGCGGCAGTTCACTCCGAATGTCTCTGCACCCTCGATGGCTGCATTCCATCGCGAGGTGACAGAGGGCGTAATCCAATTCCTCAAACCGGAATCGCCGGGAGTCGAGCTGGGAGATGACGACTTAGTCACTCCCAGCGAGGTGCGCCTCCTCATCAAGTTGATGAAGAGGCGCAAAGCCCCCGGCGAGGACGGTATTCCTCCCCTCGCCTTGCAAAACCTCCCTCCCTCAATCGTGTCAGCAATGACACGATTGTTCAATTCCATTCTCCGGGTAGGACACTTCCCTGGAACTTGGAAATTGGGCAAGATTATCGTCTTGCCCAAACCCGGCAAGGACAGGAGAAAGCCCTCCAGTTACCGACCGATTACCTTGCTCTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTCCTGAGGAGAATATCGCCGTATATTCTCCTCAGGCCGGAGCAATTCGGCTTTAGAAGCGGCCACTCGACGACTCTGCAACTGACCCGTGTCCTGCATCACTTGGCGGACCGGCGAAACTCGGGCCAATACACGGTCGCGGTCCTTCTCGATATCGAGAAGGCCTTCGACCGTGTGTGGCACGAGGGGCTGGTCCACAAGCTGCGGGACGCGGGCCTACCGCACGCTCACGTGCGACTGCTCGGGTCGTACCTGGAGGGCAGAACCTTCTTTGTCGCGGTCGAGGGCGCACGGTCTTCCGTGCGTCCCATTACGGCCGGGGTTCCCCAGGGTAGTGTCCTATCTCCTATCCTATACGCCCTCTACACCAATGACATCCCCACCCTGGAGGGTCACCTTCGGGCGTGGGAGGAGGACGTGAGGTTGGCCTTGTTCGCTGACGACTCGGCCTACTTCTCGTCCTCTCCGTTCCCCTCTGCAGCCATTATGAGGATGCAGAGGCTTTTGGATTTACTGCCCCAGTGGCTGGACCGTTGGAGAGTCGCGGTCAATGTGGGAAAGACCGCGGCCTTACTCTACGGTCCGGTCCGTATCAGAGTCGTCCCAAAGAAACTCAGCCTCCGAGGTGTGAATGTCGAGTTCAGGACCACGGTCCGGTATCTCGGATGCGACATCGACCGCTCTTTGAGCATGGTCGCGCACGTCAACCGAGTCATCGGTCAGGCTCGCGCGGCCATGTTCTTGTTGCGGCCGGTGTTTGCGTCCGGGCTTCCGACCAGGACCAAACTCGCCATTTACAAGACATACGTCCGTTCCCGCCTCACATACGCTGCTGTGGCCTGGTATCACCTGTTGTCGCCGTCCCAGCGATCTAGGTTGCAGGCCCAGCTGAGTCTTTCCCTCCGCATTATCGTCGGGGCCGGGCAGTACGTCAGAAATGACGTTATTGCCCGGGACCTAGGGGTGGAGTCGCTCGTGGAGTTTGTGACTAGGCTCGCCCGTAATATGTACGAGCGAGCCGAAAACGGGCCCCATGAGCATCTCCACAACATAGCCCCGCTGCACGCCAGACCACCGGATGGAGAGCAGCAGCCGCCCCCGGAAGAAGAAGGGAAGAAAGAAGAAAGGAAGAAAGAAGAAGGAAGAAAGAAGATGAAGAAGTGA
Protein
MSGGSPPPNISTPGPSRKGHQAIAGSPAFCSLPARPELGTGTDDRPGPSGAARGSPRIGPGESFFPLPADCSGSLRPRKKARSESDRSSSEAKDKRPRIGPSSKSLSEMEGDEAEDNEDTTSSEDSSSYDSESSGSSHSTSKSVERTSPKKKPIPKPRRSLGMVEVHPVKQLRTPPRSPSPAISPIPSVRRRGAPTLSSTVGNLESTRYMDLESTASHPKITPNPIPSPVPSTSYAAIAATQKPSTTTHRPELTKSPAPGGIRANEAPRRHPPIMVEALPNWSRHMAAIRERLGRVPSVRPYGTGFRFLPASAEEYRVVQAYLAGASSADSAVKWYCYALEEDIPARVAIRGLPADTDAAEIINALKELGFPARYARCIRAKRGRPGCVFFVTLDHLSKEGLARLYAVEELLYLPGVSVEGWRPNRGPAQCHRCQAFGHASTNCHRAVRCVRCAGEHIVADCPRPREGPLTCANCGKGHAAIDKRCVVYRRRARMMGVAIPPPVPQAATRASQAPTPAPRLGPRPSLKGKGKGKTSQPPTLPPVIEQPATVEANPTAATLMAEANPQRKAIKPRPAPRSSNKAAFNLQAALTTTTTKTQKKNKKKKIKAKEKKIKKAMEEAAALGEGQIEPATEPPCPMETTASDPLQNDNITLGDSQPPLPPRPQRERRSGRQDTQPAGFAAWLLSLWEKLSEELRIIYWNPDGIGSRRSELIRLAQEYDPQVILLGETKLKPRQDFRMPNYFVYRRDELTSSGRPFRGTAALVRRDVVHEELELLTFASTRTVGVRVHVPGAELRIYAAYRPPGPDFVEDDIRRALNHDRHPALVVGDLNAKHVAWGSRIITPPGRRLYEDAERGDYCVVGPNEPTHVPTLARYQPDVLDVCVHKGLQCPLAIEALYDLSTPHLPILVTVGLGLTRVATSPLRPRVDWQSFTGLLADQSLFQDPSTPDEVDTAASRLVDTIRGALDQVTTLVPSGGPRAELPVHLKTLIRRKRALRRLWATSRCPRIKRELNRLEGELATKMRTYRGDSWEGGLLDASDDRTMAPLHRICRRLTNKPSPTCPLEDEGGRRCFTPLARAEVLANSLERQFTPNVSAPSMAAFHREVTEGVIQFLKPESPGVELGDDDLVTPSEVRLLIKLMKRRKAPGEDGIPPLALQNLPPSIVSAMTRLFNSILRVGHFPGTWKLGKIIVLPKPGKDRRKPSSYRPITLLSHVGKLFERLLLRRISPYILLRPEQFGFRSGHSTTLQLTRVLHHLADRRNSGQYTVAVLLDIEKAFDRVWHEGLVHKLRDAGLPHAHVRLLGSYLEGRTFFVAVEGARSSVRPITAGVPQGSVLSPILYALYTNDIPTLEGHLRAWEEDVRLALFADDSAYFSSSPFPSAAIMRMQRLLDLLPQWLDRWRVAVNVGKTAALLYGPVRIRVVPKKLSLRGVNVEFRTTVRYLGCDIDRSLSMVAHVNRVIGQARAAMFLLRPVFASGLPTRTKLAIYKTYVRSRLTYAAVAWYHLLSPSQRSRLQAQLSLSLRIIVGAGQYVRNDVIARDLGVESLVEFVTRLARNMYERAENGPHEHLHNIAPLHARPPDGEQQPPPEEEGKKEERKKEEGRKKMKK

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=8.21756e-06,     Score=124

Ontologies

Topology

Length:
1610
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10387
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1610
 
 

Population Genetic Test Statistics

Pi
350.844476
Theta
180.561719
Tajima's D
3.102639
CLR
1.226638
CSRT
0.982050897455127
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号