SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02412
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 2.171
 

Sequence

CDS
ATGGAGGTCGATGTTAAGACCCCTCATATCCCCGAAAGTAGCCAAGCCATTGATGTACAAGCCGTGACTGATGCCAACTTGCCTCAGTCGCAACCAACCTCATCTCAGCCCCTTCCCCCCCGCCCTCAGCGCGAGCAGCGCAGCGGTCGGCAGGCCTCACAGCCTGCCGGCTTTGCTGCATGGCTCCTCGCGCTCTGGGAAAAATTGTCCGAGGAACTGCGCATCATTTATTGGAACCCCGGCGGGGTAAAAACCCGCAAGAACGATCTCTTGGTTCTCGCCCGGGAGTACAACCCTGAGGTTGTGCTCCTGGGCGAGACCAAGCTACGTCCTCGGGATGTGTTCAGGATTCCAAACTACTTCATGTACCGACGTGACGAGGTGAGTCCTGCCGGGACGCCGTTCAGGGGCACTGCGGCGCTCGTCAGGCGAGACGTGGTGCATGATCAGTTGGATTTGCTGGCCTTCACATCGACAAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTGAACTCAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCCGACGAACCCACGCACATTCCGACCGCCGCGCAACTCCAGCCCGACGTGTTGGATGTGTGCGTTCATAAGGGGCTACGGTGCCCCTTAACTATTGAGGCACTGTACGACCTGGGTACCCCCCATCTCCCTATCCTGGTCACACTGGGAATGGGGCTCACCCGGGTTGCGACCTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACGCCTAGTCGACCTTCCCGCAATTCAGGACCCCAACACCCCTGAGGGGGTCGACGACGCGGCAGTCCGCCTTGTCGACTCCATCAGGGGAGCGATCGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTATACTCCCGGCCCATCTGAAAGCGATTATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGATAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGCTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTATCGGGGCTATGCGTGGGAGGAACGGATCGAGGAGGCCCGTGAGGACCCCTCGTCCGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGTTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGTAATGCTGGAGCGGCAGTTCGCTCCAAATAACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGTAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGGTGATTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCATTTTTCCACTTCCCCGAAACGGTCGTGTCATTCATGACACGACTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATTGCCCTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTATCGTCCGATCACTCTGCTGTCGCATATGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCACCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCTACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTATGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCAAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCACCAGTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCCTCTAATTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGCCGTCCCAGGACAGCTCAGTCTCCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTTCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGATCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATTCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCTGGCGCTACCAAGGGAGCTACTAGAACCCCCGGCTATGGTAAGATAG
Protein
MEVDVKTPHIPESSQAIDVQAVTDANLPQSQPTSSQPLPPRPQREQRSGRQASQPAGFAAWLLALWEKLSEELRIIYWNPGGVKTRKNDLLVLAREYNPEVVLLGETKLRPRDVFRIPNYFMYRRDEVSPAGTPFRGTAALVRRDVVHDQLDLLAFTSTSRPALLVGDLNAKHVAWGSRLNSAVGRRLLEDADRGDYSVVGPDEPTHIPTAAQLQPDVLDVCVHKGLRCPLTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPKVDWELFKRRLVDLPAIQDPNTPEGVDDAAVRLVDSIRGAIDQATTLVPSGGPRGILPAHLKAIIRRKRGLRRLWAITRCPRIKRELNELEAELAAKISSYRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAVMLERQFAPNNSAPSEAAFHQSVEESVVSLLSSPVPPLGDGDFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSFMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRNPSSYRPITLLSHMGKLFERLLLRRVSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIYKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPVLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFSSSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRAVPGQLSLRGVNVEFRPSVRYLGVNIDRSLRMTAHAKSALAAARYARFLLRPVLASRLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQIMRVKLQAQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGLALPRELLEPPAMVR

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
NWSH01000895    PCG73652.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02023911    + More
ABLF02034467    GEZM01008457    JAV94772.1    ABLF02041767    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01017470    PNF24199.1    ABLF02028535    ABLF02028545    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NEVH01021205    PNF19912.1    GFTR01008279    JAW08147.1    NEVH01011985    PNF31054.1    GGMR01004661    MBY17280.1    ABLF02042518    ABLF02057746    GALX01005299    JAB63167.1    GFTR01008262    JAW08164.1    ABLF02017815    GBBI01004395    JAC14317.1    NEVH01007402    PNF35856.1    GALX01005359    JAB63107.1    ABLF02055645    GGMR01003407    MBY16026.1    NEVH01006736    PNF36716.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01008277    PNF34262.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NEVH01016302    PNF25823.1    NEVH01005277    PNF39135.1    KK119261    KFM75202.1    ABLF02021177    ABLF02027367    ABLF02066338    NEVH01023979    PNF17579.1    ABLF02008463    NEVH01016340    PNF25410.1    NEVH01015305    PNF27092.1    NEVH01021925    PNF19341.1    NWSH01000032    PCG80496.1    NEVH01001347    PNF42959.1    KQ971729    KYB24751.1    GFXV01000908    MBW12713.1    NEVH01026386    PNF14434.1    GFTR01008254    JAW08172.1    KQ459265    KPJ02064.1    NEVH01020940    PNF20481.1    AB055391    BAB21761.1    ABLF02017813    GGMS01017365    MBY86568.1    AB018558    BAA76304.1    GBBI01003747    JAC14965.1    GFTR01008246    JAW08180.1    GGFL01004957    MBW69135.1    KQ973342    KXZ75569.1    GBGD01000389    JAC88500.1    GGMS01002992    MBY72195.1    GBGD01000415    JAC88474.1    GEZM01053022    JAV74219.1    NEVH01014858    PNF27387.1    GFTR01008038    JAW08388.1    GBBI01004571    JAC14141.1    NEVH01019964    PNF22161.1    AF081103    AAC72921.1    NEVH01007838    PNF34986.1    NEVH01006754    PNF36554.1    NEVH01002716    PNF41415.1    GEZM01084969    JAV60363.1    GFTR01008269    JAW08157.1    GBBI01003810    JAC14902.1    GFTR01007929    JAW08497.1    NEVH01022639    PNF18527.1    KU543687    AMS38379.1    ABLF02041861    GFTR01008271    JAW08155.1    KK119692    KFM76444.1    GGMS01006359    MBY75562.1    GGMR01012283    MBY24902.1    M22874    M38643    NWSH01007753    PCG62823.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    ABLF02029306    ABLF02029314    ABLF02060138    U07847    AAA17752.1    GGMR01016296    MBY28915.1    GGMR01003864    MBY16483.1    GFTR01008260    JAW08166.1    M17214    AAA28508.1    GGFJ01001822    MBW50963.1    GGMR01000676    MBY13295.1    NEVH01006721    PNF37225.1    GGMR01000226    MBY12845.1    GGMR01012443    MBY25062.1    LBMM01018163    KMQ83860.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.000788553,     Score=105

Ontologies

Topology

Length:
936
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03626
Exp number, first 60 AAs:
0.00063
Total prob of N-in:
0.00037
outside
1  -  936
 
 

Population Genetic Test Statistics

Pi
140.605022
Theta
157.767727
Tajima's D
-0.443287
CLR
640.099902
CSRT
0.255187240637968
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号