SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02369
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.627
 

Sequence

CDS
ATGTCTGGGGATCACTCACCCCCCATAATCAGCACTCCCGGCCCGTCTCGTAAGGGACGTCAGGCGATGGCCGAATTACGGACCCATAGACCTGAACCAATTATTCGTACAGTCCCGATGGGGTTCGGAACTGACAATCGGCCCGGGCCTTCGGCCTCGGCCGAGGGTCCTCCGAGGATCGAACCGAGGGAAGGTGCCCTTCCCTCGTTGACCGATCCCTCGGGGCCCTCTCGGCCGCGGAAGAAGGCCAGGTCCGAGTCGGACCGAGGCTCATCGGACCAAGATAAACGACCAAGAATAGGCCCCTCCTCCAAATCGGAGGGAGAGGATAGCGAGGCCACGTCTTCCGCCCCGTCCTCTTCCAACTCCAACTCCAACTCAAATTCTGTTTCTCCTTCTTCATCAAGGTCCTCATCCCCCACTGGGAGTCCCATCCCAGTAGCTAAACCCATTCCCAAACCGAGGGCCCCCACCAGGACAGGGGTAGCCCCACGTCAACTCAGATCCCCTCCTCGATCCCCTTCCCCGACCATATCCCCCATCCCAGTGGATCCAACTCGAGGTGCCCCCGCCCTAAGCGGCACGGCGGGCAACCTGGATTCAACCAGGTATATGGATCTCGAGTCCACTAAAGCCCAACAGGTCCCTAACCCGTACCAACCCACTCCCTCAACATCTTATGCGACCATAGCCGCATCCCAACCCCCAGTGGGTACTCGCCCCAGACCCACCCAAACCCAAGTCCCTCCACCCCCGAGGCCGAGGGGTCGGGTCCAGGAGGAGCTCCGCCGGCATCCACCCATCATGGTGGAAGCTCTCCCGAACTGGTCTCGCCATATGGCAGCCATTAGGGAGCGCCTCGGTAGGGCTCCTTCTGCCAGACCCCACGGCGCCGGTTTCCGCTTCCTGCCGTCATCGGCGGAGGAGTACAGGGTGATCCAGGACTATCTTTCGAGGGCCTCCGCCGCAGACAAAGCCATTAAATGGTTTTGTTATGCGCTGTCGGAGGAAATACCCTCGAAGGTGGCCGTCCGGGGTCTCCCTGCCGACACCGATGCGGCGGAAGTTACGAACGCCCTCAAGGAGCTGGGCTTTCCTGCTCGATATGCCCGGTGTATTCGGGCCAAGAGAGGGAGACAGGGCTGCGTTTTCTTCGTGGCCTTGGACCACCTCTCTAAGGGTGACCTCGCCCGGCTGTATTCAGTGAATGAACTGATGTACTTGCCGGGGGTGACGGTTGAGGGATGGCGTCCAAACCGAGGACCTGCGCAGTGTCACCGCTGCCAGGCCTTCGGTCACGCGTCCACCAATTGTCACCGTGCGGTTCGCTGCGTTCGATGTGCCGGCGAGCACATTGTGGCGGACTGCCCGAGGCCAAGGGATGGCCCATTATCCTGTGCAAATTGCGGGAAGGACCACGCCGCCATCGATCGGCGGTGTGTGGTCAACCGCAAGAGGGCCAGGATGATGGGAGTACCCATCCCCCCTCCTGTACCACCGGTGCCTCGGCCCAGGAATGTCCCGGCTCCCGTCGCACCTGTTCCCATCCCTAAGGGGAAGGGGAAGGGGAAAGGGAAATCTTCCCAAACCCCAGCCCCTCCCCATCCTAGTACCATTCCGTCTGTCTCGGTAGTGGAAGCAGCGCCGTCAGCGACCACGCTGATGGCGCAGGCCAACCCGCCGCGACAGACCAAAACGCCCAACCCCACTCCTCGTGGCCGAGCCCAAATTATAGCTGTTACCACAGCCCGCGACACTCGCCAGACAGCCGGCTCAGCCCCTAAATCCTCAAAAAATAAAAATAAAAATAAAAAAAAGAAGGAGAGGAGGAAACTATTAAAGAAAATGGCGAGAGAGAGCAGCGCCAGAAACATGGAAGTGGACCAACAACCTCATGAGGCCATGGAAGCCAACGAAACTGCCGACCCTAACCCTCCACAACTGGAGGGACAAACATTGCCTCAAGCTCAACCTGAGCAGTTGGGCAATACTCTGCCCCCTCTTCCCCCCCGCCCTCAGCGCGAGCAGCGCAGCGGTCGGCAGGCCTCACAGCCTGCCGGCTTTGCTGCATGGCTTCTCGCGCTCTGGGAAAAATTGTCCGAGGAACTGCGCATCATTTATTGGAACCCCGGCGGGGTAAAAACCCGCAAGAACGATCTCTTGGTTCTCGCCCGGGAGTACAACCCTGAGGTTGTGCTCCTGGGCGAGACCAAGCTACGTCCTCGGGATGTGTTCAGGATTCCAAACTACTTCATGTACCGACGTGATGAGGTCGATCGGTGTGAGGATCCACACCTCGGGGGAGATATGCGGGTTTATGCCGCGTATAGACCCCCGGGGCCTGATTTCCACCCCGGGGACATAAGACGGGTCCTGAATTGCGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTGAACTCAGCGGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCCGACGAACCCACGCACATTCCGACCGCCGCGCAACTCCAGCCCGACGTGTTGGATGTGTGCGTTCATAAGGGGCTACGGTGCCCCTTAACTATTGAGGCACTGTACGACCTGGGTACCCCCCATCTCCCGATCCTGGTCACACTGGGAATGGGGCTTACCCGGGTTGCGACCTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACTCCTAGTCGACCTTCCCGTAATTCAGGACCCCAACACCCCTGAGGGGGTCGACGACGCGGCAGTCCGCCTTGTCGACTCCATCAGGGGAGCGATCGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTATACTCCCGGCCCATCTGAAAGCGATTATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGCTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTATCGGGGCTATGCGTGGGAGGAACGGATCGAGGAGGCCCGTGAGGACCCCTCGTCCGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGTAATGCTGGAGCGGCAGTTCGCTCCAAATAACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGGTGATTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCATTTTTCCACTTCCCCGAAACGGTCGTGTCATTCATGACACGACTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAACTTGGAAATTGGGCAAGGTTATTGCCCTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTATCGTCCGATCACTCTGCTGTCGCATATGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCACCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCTACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTATGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCAAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCACCAGTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCCTCTAACTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGCCGTCCCAGGACAGCTCAGTCTCCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTTCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGATCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCAGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGTTCGAGACAGCGAGCCGACGAGTCCAGACCTCTCCAAAGAAGAGGAGAGCGCCAACCGAACAAGAAAAGACTCGCTCCTACGCCCTGCGCCGGTCAAGCCACGAGGACCGTGTGAACGCCATACTGAAGCCTTCGTTATTTTCCTCGAACCAATCCCAGCACCCGTTCCGCGACAGCCACTGCGGCAATACTCGAGCCACCACGTTTCAACGAGAGTAA
Protein
MSGDHSPPIISTPGPSRKGRQAMAELRTHRPEPIIRTVPMGFGTDNRPGPSASAEGPPRIEPREGALPSLTDPSGPSRPRKKARSESDRGSSDQDKRPRIGPSSKSEGEDSEATSSAPSSSNSNSNSNSVSPSSSRSSSPTGSPIPVAKPIPKPRAPTRTGVAPRQLRSPPRSPSPTISPIPVDPTRGAPALSGTAGNLDSTRYMDLESTKAQQVPNPYQPTPSTSYATIAASQPPVGTRPRPTQTQVPPPPRPRGRVQEELRRHPPIMVEALPNWSRHMAAIRERLGRAPSARPHGAGFRFLPSSAEEYRVIQDYLSRASAADKAIKWFCYALSEEIPSKVAVRGLPADTDAAEVTNALKELGFPARYARCIRAKRGRQGCVFFVALDHLSKGDLARLYSVNELMYLPGVTVEGWRPNRGPAQCHRCQAFGHASTNCHRAVRCVRCAGEHIVADCPRPRDGPLSCANCGKDHAAIDRRCVVNRKRARMMGVPIPPPVPPVPRPRNVPAPVAPVPIPKGKGKGKGKSSQTPAPPHPSTIPSVSVVEAAPSATTLMAQANPPRQTKTPNPTPRGRAQIIAVTTARDTRQTAGSAPKSSKNKNKNKKKKERRKLLKKMARESSARNMEVDQQPHEAMEANETADPNPPQLEGQTLPQAQPEQLGNTLPPLPPRPQREQRSGRQASQPAGFAAWLLALWEKLSEELRIIYWNPGGVKTRKNDLLVLAREYNPEVVLLGETKLRPRDVFRIPNYFMYRRDEVDRCEDPHLGGDMRVYAAYRPPGPDFHPGDIRRVLNCDSRPALLVGDLNAKHVAWGSRLNSAVGRRLLEDADRGDYSVVGPDEPTHIPTAAQLQPDVLDVCVHKGLRCPLTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPKVDWELFKRLLVDLPVIQDPNTPEGVDDAAVRLVDSIRGAIDQATTLVPSGGPRGILPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSYRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAVMLERQFAPNNSAPSEAAFHQSVEESVASLLSSPVPPLGDGDFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSFMTRLFNSILSTGHFPGTWKLGKVIALPKPGKDRRNPSSYRPITLLSHMGKLFERLLLRRVSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIYKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPVLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFSSSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRAVPGQLSLRGVNVEFRPSVRYLGVNIDRSLRMTAHAKSALAAARYARFLLRPVLASRLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQIMRVKLQAQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGQALPRELLEPPAMFETASRRVQTSPKKRRAPTEQEKTRSYALRRSSHEDRVNAILKPSLFSSNQSQHPFRDSHCGNTRATTFQRE

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.000452987,     Score=109

Ontologies

Topology

Length:
1642
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01389
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1642
 
 

Population Genetic Test Statistics

Pi
332.4624
Theta
166.691635
Tajima's D
-1.351065
CLR
72.197384
CSRT
0.0841457927103645
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号