SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02334
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.316 Nuclear   Reliability : 1.995
 

Sequence

CDS
ATGGACGCTGTGTTCGCGGAATTCCTCCGACTTCGTCATCCACAGCTCGCCTCAGAGTTTCTAGCTTTCAAGGCCAATCACACTGCGAGCCCTCTCGAAGACTCCGCCGTGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAAAGCTTCTACATCGAGCACCGCAACCTCGGTCGTGCCTGCCGTTCCCGCGTCGCCTATACTGGCGAGTAAAACTGCTGCGTCGTCCACCGTGGCCACCGTTCCAGCTGTGCGATCATCCGCGGCCTCCGTCGCGCCCTCCAAAACACCTGCTCGTAGGTCACCGGCGCCCTCCTCCTCGTCCTCCGACTCTGACTCGGAGATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGGATTTACCCTGGTACAAAAGGGTAAGAAGCGTGCCGCGGAGTCCCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGCGAACGCGTCGCGCCCCCGCCCCCAGACTCCCGTTGCGCCTCCAGCCCGTGCCAGTCCGTCGCCGCGTCCGGTGGCACAAAATAAAACCCAGTCCCCTCCTCCGGTAATCCTTCAAGAGAAGGCAGCTTGGGATCGAGTTTCCCTGGCCCTTAAGGCCAAAAATATCAATTTCACGAATGCCCGTAACCTCGCGAACGGCATCCAAATAAAGGTGCATTCATCTGATGACCATAGGACCCTCACCTCTTACCTCCGTAAGGAGCGTATAAGCTTCCACACTTATACGCTCCAGGAGGAGCGCGAACTCCGCGTTGTAATACGCGGAATCCCTAAAGAGTTAGATGTAGAGCTCGTAAAAGCCGACCTGTTAGAACAAGGCCTACCAGTGAATTCTGTGCACCGTATGCACACCGGTCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCTCTCCAGCCTACCCCGAGGGAGACCCTACTTAAGCCCGCGCGCCGTGACCCTAAAATCGCGAACTATAACATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCACTTCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGTTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCTGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACATCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGATATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTTGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTTACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGTTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAGCTGTATGAGCGTCTGCTCTACAAGCGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGCCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MDAVFAEFLRLRHPQLASEFLAFKANHTASPLEDSAVLAAPASPVPACKASTSSTATSVVPAVPASPILASKTAASSTVATVPAVRSSAASVAPSKTPARRSPAPSSSSSDSDSEMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKAANASRPRPQTPVAPPARASPSPRPVAQNKTQSPPPVILQEKAAWDRVSLALKAKNINFTNARNLANGIQIKVHSSDDHRTLTSYLRKERISFHTYTLQEERELRVVIRGIPKELDVELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPRETLLKPARRDPKIANYNMVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNLDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSALSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGNRTRRTRQRGRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    ABLF02042518    ABLF02057746    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02034467    NEVH01006736    PNF36716.1    GFTR01008279    JAW08147.1    NEVH01017470    PNF24199.1    NEVH01021205    PNF19912.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    ABLF02023911    NEVH01009134    PNF33528.1    GGMS01002992    MBY72195.1    GFTR01008261    JAW08165.1    GGFJ01001858    MBW50999.1    NEVH01016302    PNF25823.1    GGFJ01001857    MBW50998.1    GGFL01004957    MBW69135.1    GFTR01008256    JAW08170.1    GBGD01000415    JAC88474.1    GGFL01005012    MBW69190.1    KK119692    KFM76444.1    NEVH01020940    PNF20481.1    GFTR01008251    JAW08175.1    GGFJ01001822    MBW50963.1    GGMR01003864    MBY16483.1    GFTR01008271    JAW08155.1    S59870    AAB26437.2    AF237761    AAF81411.1    GGMS01017365    MBY86568.1    GGFJ01001844    MBW50985.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    GEZM01084969    JAV60363.1    GFTR01008151    JAW08275.1    GFTR01008257    JAW08169.1    RPOV01000134    RPJ78669.1    GFTR01008246    JAW08180.1    GFXV01002840    MBW14645.1    GGMR01006408    MBY19027.1    GBBI01003810    JAC14902.1    GFTR01008260    JAW08166.1    GGMR01011511    MBY24130.1    NEVH01019963    PNF22185.1    GGMR01012305    MBY24924.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.0530684,     Score=90

Ontologies

Topology

Length:
1200
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.11811000000001
Exp number, first 60 AAs:
3e-05
Total prob of N-in:
0.00008
outside
1  -  1200
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
24.890255
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号