SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO02120
Pre Gene Modal
BGIBMGA003166
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.194
 

Sequence

CDS
ATGACCGAATTGGACTTATCAAATACTGGTAGAGGAGTATGGTTGGTAAAAGTACCTAAATATATAGCAAACAAATGGGAAAAAGCTCCTGGAAACATTGAGGTAGGAAAACTAAAGATCTCCAGAGTACCAGGAACGAGAGCTAAAGTGCAGTTATCCTTGTCAGAAGCAGTGCTATGTTTAAAGGACCCTGGTGAACAAAGCATACCAAAAGAACATAAGCTTGATGTTTCAAACGTTAATACTCAATCTCTAGGTGTATTTTCGCATATTGCCCCGACAAATACGGACTCTGTAGTACCAGAGACAGAAAACCTTTACATGGAGGGTAGGATTGTACAGAAATTGGAATGCAGACCAAATGATGATGTGACATACTATAAGCTTAAATCTGAATCAATAAAGAAAGCATCCATGCCTCAGCGACAAGTGCAACAGCTTGACAGGATTGTTCAGAACTTCAAACCAGTATCTGACCATCCACATAATATTGACTACCAAGAAAGGAAGAAGGCTGAAGGGAAAAAGGCTCGTGATGATAAAGAAGCAGTGCTCAATATGCTGTTTGCAGCATTTGAGAAACATCAGTATTACAATATTAAGGATCTTCAAAAGATCACCAGACAGCCAATAGTATATTTGAAAGAAATTCTGAAAGAGGTCTGTAATTACAATTTAAGAAATCCTCACAAGAATATGTGGGAGTTAAAACCAGAATATAGGCATTACAAACAAGATGTTCCTGTTGAAACAAAGGAGGATAAGAACAGTCCGAGAAGTTGGGGCCTCGCCGCAAGGCGAGTGTTTTCAAGACCCGGGGCCGCCCCACCTGGGTACTCAGCGATCATGGACGCTGTATTCGCGGAATTCCTCCGACTTCGCCACCCACAGCTCGCCTCGGAGTTTTTGGCCTTCAAGGCCAATCACACTGCGAGCCCTCTCGAGGACTCCGCCGCGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAGAGCTTCTGCATTGAGCACCGCAGCCTCTGTCGTGCCTGCCGCTCCCGTGTCGCCTATACTGGCGAGAAAAGCTGCTGCGTCGTCCGCCGTGACCATCGTTTCAGCTGAGCGATCATCCGCGGCCTCCGTCGCGCCCTCTAAAACACCTACACTTGCTCGTAGGTCGCCTGCACCCGCCTCCTCGTGCTCCGACTCTGACTCGGACATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGGATTCACCCTGGTACAGAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGTGAACGCGTCGCGCCCCCGCCCTCAGACTCCCGTTGCGCCCCCAGCCCGTGCCACTCCGTCGCCGCGTCCGGTGGCACAAAATAAAACCCAGACCCCTCCCCCGGTTATCCTTCAGGAGAAGGCAGCTTGGGATCGAGTTTGCCTGGCCCTTAAGGCCAAAAATATAAATTTCACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCAAACACCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCATACGTATACGCTCCAGGAGGAGCGCGAACTCCGCGTTGTAATACGCGGAATCCCTAAAGAGTTAGATGTAGAGCTCGTAAAAGCCGACCTGTTAGAACAAGGCCTACCAGTGAATTCTGTGCACCGTATGCACACCGGTCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCTCTCCAGCCTACCCCCGAGGGTAAGAAAATCTTTAACACACAGACCGTCTGTAGGCTCTCTGGTATCGCTGTCGAAGCCCCCCATAAAAAAGGCACTCCTAGCCAGTGCCATAACTGTCAATTGTACGGGCACTCTTCCCGTAACTGTCACGCGCGCCCCCGATGTGTTAAGTGTTTGGGCGATCACGCCACGGCCCTCTGCGCTCGCGACCAAAAAACCGCGACGGAACCGCCTAGCTGCGTCCTGTGTCGAACACAGGGTCACCCCGCGAATTACCGTGGTTGCCCCCGAGCCCCTAAAATAAATCGCCGCGTCGCCCGCCAAAACCGCCTCCGAGCTTCCGGCCCAGACATCAAAGCCTCGGCACCCTCTGCGTCGCAGGCTAAGCCAGCGTTCGTTCCGGCGGCGGTGCCCAGTGTCTCGGCCTGGGCAAAACCGCTGCCGTACACGAACACGGCTACAACTCCCTCCTCCGCGATTCGTCCCGCCCCCGCGACTCGTCCCTCTCCCGCGACTTGCCCTCCGACCGCGTCCGACAATCTCGCTTTAGCGATCGACTTCTTTCAGTCGATCAACTTTGAGCGCGTTAACGCTTTGGGCGACGCCATTCGCGCTGCCTCCACTGCACAACACTTTATCGCCGTTGTGCAGGAATACGCCGACGTATACGCGTCATTAAATACGTACGTCCTCCCCTCACTCCGCCGGTAA
Protein
MTELDLSNTGRGVWLVKVPKYIANKWEKAPGNIEVGKLKISRVPGTRAKVQLSLSEAVLCLKDPGEQSIPKEHKLDVSNVNTQSLGVFSHIAPTNTDSVVPETENLYMEGRIVQKLECRPNDDVTYYKLKSESIKKASMPQRQVQQLDRIVQNFKPVSDHPHNIDYQERKKAEGKKARDDKEAVLNMLFAAFEKHQYYNIKDLQKITRQPIVYLKEILKEVCNYNLRNPHKNMWELKPEYRHYKQDVPVETKEDKNSPRSWGLAARRVFSRPGAAPPGYSAIMDAVFAEFLRLRHPQLASEFLAFKANHTASPLEDSAALAAPASPVPACRASALSTAASVVPAAPVSPILARKAAASSAVTIVSAERSSAASVAPSKTPTLARRSPAPASSCSDSDSDMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKAVNASRPRPQTPVAPPARATPSPRPVAQNKTQTPPPVILQEKAAWDRVCLALKAKNINFTNARNLANGIQIKVQTPDDHRALSSYLRKERISFHTYTLQEERELRVVIRGIPKELDVELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEGKKIFNTQTVCRLSGIAVEAPHKKGTPSQCHNCQLYGHSSRNCHARPRCVKCLGDHATALCARDQKTATEPPSCVLCRTQGHPANYRGCPRAPKINRRVARQNRLRASGPDIKASAPSASQAKPAFVPAAVPSVSAWAKPLPYTNTATTPSSAIRPAPATRPSPATCPPTASDNLALAIDFFQSINFERVNALGDAIRAASTAQHFIAVVQEYADVYASLNTYVLPSLRR

Summary

Uniprot
ProteinModelPortal
PDB
6O9L     E-value=2.24566e-59,     Score=583

Ontologies

Topology

Length:
824
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01505
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00006
outside
1  -  824
 
 

Population Genetic Test Statistics

Pi
242.208612
Theta
174.092944
Tajima's D
0.426424
CLR
0.011914
CSRT
0.500074996250187
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号