SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01858
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 3.405
 

Sequence

CDS
ATGGAGTTTTCTCCAACCAACACACTGCTCGCGGAATTCTTAAGCGAGAAATACCCGGCCCTCGAATCAGAATTTTTAGCTTACAAAGCTAAGCGCGCCGTGAACTGTTCTGCCGTGCCCGCCGCGCCCGCCGTTTCCGCCACGCCTGCCGTTCCCGCGTCCCCTGCAAGCGCGCGCAAAACTCCCGCGCCGTACACCGCAGCCTCCGTCGCGCCCAGCACACCCGTGTCCCCCATACTGTCGCGAAAAACTCCCGCGTCTACCGCGGCAGCTTCCGTTCTACCTCAGCGATCGTCTGCGGCCTCCGTCGCGTCCGCCGCTCCCGCGCCTTCCTCCTCGTCCTCCGACTCTGACTCGGATATGGAGGTTGACCTCGTTCCCGCCTCATTAACAGATGGATTCACTCTCGTGCAAAAGGGTAAGAAGCGCGCCGCGGAGTCCCGAGCTTCCGCGGCCGCTAAAATAAGCAAAGCCGCGAACGCGTCGCGCCCCCGCCCTCCGACCCCCGTCGCTCCCTGTCCCCGTGCCACGCCGTCGCCGCGCCCGGTGGCACAAACGAGAAATCAAGCCCCTCCTCCGTTGATTCTTCAAGAGAAGGCTGCTTGGGACCGTATCTCCCTGGCCCTTAAGGCCAAAAACATAAATTTTGTCAGTGCCCGTAACCTCGCGAACGGGATACAAATAAAAGTAGCAACACCCGACGACCATAGGGCACTCTCAAGCTACCTCCGAAAGGAGCGTATAAGTTATCATACGTATACGCTCCAGGAGGAGCGTGAGCTCCGTGCAGTCATACGTGGCATCCCCAAGGAGTTAGATGCCGAGCTCGTAAAGGCCGACCTACTCGAACAAGGCCTACCCGTAAACTCCGTGCACCGCATGCACACAGGACGCGGGAGGGAGCCATACAATATGGTTCTCGTCGCCCTCCAGTCTACCCCCGAGGGTAAGAAAATCTTTAACGTCCGAACTGTCTGTAGGCTTTCCGGAATCACCGTGGAAACCCCTCATAAAAAAGGCACTCCGAGCCAGTGCCACAATTGTCAGTTGTACGGGCATTCTTCCCGTAATTGTCACGCGCGCCCTCGATGCGTCAAGTGTTTGGACGATCACGCCACGACTCTTTGCACTCGCGATCAAAAAACCGCGACGGAACCACCTAGCTGCGTCCTGTGCCGAACACAGGGTCACCCCGCGAATTACCGTGGATGCCCCCGAGCCCCTAAAATAAATCGCCGCGTTGCGCGTCAAAACCGCCTCCGAGCTTCCGGCCCTGACATCAAAGCCACGGCACCCTCTGTGCCGAAGGCTAAGCCTGCCTTCGTGCCGGCGCCGGTGCCCAGCGGCTCGGCCTGGGCTAAACCGTTGCCGTACACGAACACGGCTGTAGCTCCCTCCCCCGCGGTTCGTCCCGTCCCCGCGATACGTCCCTCCCCCGTGATTCGTTCCTCCCCCGCGACCAGCACTCCGACCGCGTCCGACAATCTCGCTCTAGCGATCGACTTTTTTCAGTCGATCAACTTTGAGCGTGTTAATGCTTTGGGTGACGCCATTCGCGCCGCCTCCACTGCACAACACTTCATCGCCGTTGTGCAAGAATACGCTGACGAGACCCTGCTTAAGCCCGCGCGCCGCGACCCTAAAATCGCGAACTATAACATGGTTAGGAACGACAGGCTCACTGCTCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCACTCGACCCCCCCGCGCTTTCTAACATCGAAGCATCAGTATGCCGAATCTCACTGACTGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGAAGCTCTGTCATTCTGGTGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACACCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCAATCGAAGTAGTTTCAGAGTTAGATTCAGACCATCGTCCCGTCGTTATGAAGCTCGGTCGCCCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCTTGGCTGAATCTGATCCACCATCGCTCCCGTTGAGCCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACACCTCGATCCGCGCCTACGATCGGTATCCTACCATGGATAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAAGACTCGCGCCCTCTCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCCCAGGCCGACTCGCGGCATTCGATGATGATGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTACCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGATAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTTGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTGAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGATGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCTAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGATGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGTGACTCCAATTGCATTTGCCTGAAAAAGATGGATACTACTCCGGAAAAAGCCGCTCAAGTCGTCGCTCTAATTGAAGCGGGCCAGAACCAGAGTGCTGTAGCTCGACAACTGAATATCAGCCGATATTCACTTCGTCGTGTGTACCAGCGCTATCCGGAGACTGGTGGCTTTGAAAGGCGACGAGGATCTGGTCGAGCAAGAGCTACAACACAGCGCGACAACAGATTTCTTGTAACGACAGCGTTGCGAAATCGTCGTTTGACTGCCGTTGAACTTGCACAGCAGCTTCAACAGGTGCGTGAAGTGGTAGTCAGCAGGTGGACAGTCAGAAGGAGACTTGCCGAAGGTGGTTTGACTGCGCATAGGCCAGCAAATGGCCCTAAATTGACGCCAGCTCACCGCCGGGCTCGTTTTCGATTTGCACAAGAACACGTCAACTGGACAGCCGACCAGTGGAAAGCAGTCCTGTTCTCAGACGAGTCCAGAATGTGTCTTCATGATAATGATGGACGTGGAAGGGTCTACAGAAGGCGCTCAGAGCGATTTTCCCAATGTTGCATCACAGAACGTGTAGCATACGGCGGTGGTTCGTGTATGTTCTGGGGAGGTATCTCACTCGAACGAAAAACAGAGCTTGTCTTCATCGTTGGGGCCAATATTAGGCGACAAACAAGAGGTCTAACATCTCAACGATACATAGAGGAAGTTCTACAAGAACATGTCGTACCATTTGGCCGTTTAATTGGAAGTAACTTCCTTTTTATGCATGACAATGCAAGACCTCATACCGCTGCGATAGTGAGACAATACTTACAAGAAGTAAATGTACCCGTGATGGAGTGGCCAGCTCGGAGCCCGGACCTTAATCCGATTGAACACTTGTGGGACGAATTAAAAAGAAAAATTAGAGGTCGAAATAGTGCTCCAGCTAATCTCCAGGAGCTACAAAATGCGCTCAAAGAGGAATGGGACGCCATGCCACAAGACTTTATCAGAAACTTGATAGAGTCGATGGGGAATCGGTGTGAAGCTGTAATTCGCGAAAGAGGGGGCAATACTTGTTACTAA
Protein
MEFSPTNTLLAEFLSEKYPALESEFLAYKAKRAVNCSAVPAAPAVSATPAVPASPASARKTPAPYTAASVAPSTPVSPILSRKTPASTAAASVLPQRSSAASVASAAPAPSSSSSDSDSDMEVDLVPASLTDGFTLVQKGKKRAAESRASAAAKISKAANASRPRPPTPVAPCPRATPSPRPVAQTRNQAPPPLILQEKAAWDRISLALKAKNINFVSARNLANGIQIKVATPDDHRALSSYLRKERISYHTYTLQEERELRAVIRGIPKELDAELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQSTPEGKKIFNVRTVCRLSGITVETPHKKGTPSQCHNCQLYGHSSRNCHARPRCVKCLDDHATTLCTRDQKTATEPPSCVLCRTQGHPANYRGCPRAPKINRRVARQNRLRASGPDIKATAPSVPKAKPAFVPAPVPSGSAWAKPLPYTNTAVAPSPAVRPVPAIRPSPVIRSSPATSTPTASDNLALAIDFFQSINFERVNALGDAIRAASTAQHFIAVVQEYADETLLKPARRDPKIANYNMVRNDRLTARGGGTVIYYRRALHCVPLDPPALSNIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILVGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRPPDSVPVTRTVVDWHTLGISLAESDPPSLPLSPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNTSIRAYDRYPTMDNRIRMRALQRDVKSRIAEVRDARWSDFLERLAPSQRSYYRLARTLKSDTVVTMPPLVGPPGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPDKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLLNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKMTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCSDSNCICLKKMDTTPEKAAQVVALIEAGQNQSAVARQLNISRYSLRRVYQRYPETGGFERRRGSGRARATTQRDNRFLVTTALRNRRLTAVELAQQLQQVREVVVSRWTVRRRLAEGGLTAHRPANGPKLTPAHRRARFRFAQEHVNWTADQWKAVLFSDESRMCLHDNDGRGRVYRRRSERFSQCCITERVAYGGGSCMFWGGISLERKTELVFIVGANIRRQTRGLTSQRYIEEVLQEHVVPFGRLIGSNFLFMHDNARPHTAAIVRQYLQEVNVPVMEWPARSPDLNPIEHLWDELKRKIRGRNSAPANLQELQNALKEEWDAMPQDFIRNLIESMGNRCEAVIRERGGNTCY

Summary

Uniprot
ProteinModelPortal
PDB
5CR4     E-value=7.62114e-28,     Score=314

Ontologies

Topology

Length:
1696
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.39175
Exp number, first 60 AAs:
0.00628
Total prob of N-in:
0.00030
outside
1  -  1696
 
 

Population Genetic Test Statistics

Pi
0.123405
Theta
0.627894
Tajima's D
0
CLR
1.595384
CSRT
0.466726663666817
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号