SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01737  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA006132
Annotation
PREDICTED:_zinc_finger_protein_Gfi-1b_isoform_X2_[Bombyx_mori]
Transcription factor
Location in the cell
Mitochondrial   Reliability : 1.264 Nuclear   Reliability : 1.431
 

Sequence

CDS
ATGAAAATAAATGGAGATTTATCAAAACCGTCAGGTGGTCCACGAGGTCGCAATTTTATACAGATGAAGTGGAAAGAGTTAACGGGAATATTAAATAGCGATTCTTCAGGAGATCCTAAGAGTGAGGACAAATGGCGTAAGGTGTGGAGTGATTATAAGAATAATTGCAAGAAAAAGTGTGCTAAAATTAACAGAGCTGCTAGTGGCACTGGTGGCGGACCAGCGCTCCATTTATTATTAACTGACCTTGAACAAAGGGTCATGCAGATAATTGGAGTGCAGGCAGCTACTGGCATGGAAATAAAAGAAGCTGGGTTTCCACAAGAAGAAATTTCAACTGAGAGGCCAAATACTGAAATTATTTTAAAGGAACCAGAAATAGATATAGACAGAAAGACAAGGGAGTATGCTTCAGAGCGTGATAGGGTATATGAGGAATTAGAGAGAGATCGGTTGAGAGTTAGAGAATTTGAGGTACGAGAAAGAGTAAGACAGCGAGATGAAGAGCTACGGATGCAGGGTCAATGGCTGGAATTTATGAAAGAGGCAATGGAAGCTTTTGTGAGAAATGGAGATTTATCAAAACCATCAGGCGGTCCACGAGGTCGCAATTTTATACAGATGAAGTGGAAAGAGTTAACGGGATTACTAAATAGCGATTCTTCAGGAGATCCTAAGAGTGAGGACAAATGGCGTAAGGTGTGGAGTGATTATAAGAATAATTGCAAGAAAAAGTGTGCTAAAATTAATAGAGCTGCTAGTGGCACTGGTGGCGGACCAGCGCTCCATTTATTATTGACTGACCAAGAACAAAGGGTCATGCAGATAATTGGAGTGCAGGCAGCTACTGGCATGGAGATAAAAGAAGCTGGGTTTCCACAAGAAGAAATTTCAACTGAGATGCCAAATACTCAAATTATTTTAAAGGAACCGGAAATAGATTGGAATGCTCCTAGCACAAGCAGCCAACCAACAGTGGCTCCACCACCACCAACTGAGGCTCCCCCTCCAGTCATTAACGAGGAAGAGGAGTGGAACCCTCCGCCGCAGAAAAAAAGAAAAAACAATTTAACAAAAATATTTTTAGATATAGACAGAAAGGCAAGGGAGCATGCTTCAGAGCGTGATAGGGTATATGAGGAATTAGAAAGAGATCGGTTGAGAGTTAGAGAATTTGAGGTACGTGAAAGAGTAAGACAGAGAGATGAAGAGCTACGGATGCAGGAAAAAATCAAGTTTGGCATCAATCGGCTAGTCGGCGATAGAACGGACGAGGATGAAGAAGAACTACACAACAATGAGACTAGAGCTGAAGGCACATCACCAGCTTCACGATGCGGCAGTCCATGCTGGGCTCCATCTCCTCAATCGCCAAGATCAGTTCGATCCAGTTCACCTGAACTTGAAGTGGATTCTCCACCTTCATCACCACGGAGACAGCCCGACTCATCACCTCCACCAAAACGATCAGAAGCATTCTCGGTCAGCGCATTGTTGAGACCAGATGCCCCAAGAGTTCAACCTCAAAGACCATTTTTATATCCACCTTTACCTTTTGCTGAGTTCTTGAGAGACGCTGGCGGCCTTGGTCTCCACGGATGGGGAGGCTACAGTAACCTATATCTTCATGCCGTACAAGCTGCAGGGCCGGAATTGTTGAGGCTTCGAGCGGCAGTGCTTGGAGCTCCAGGACCTCTGACCAGGCCATTGCCGATCGGAGATGTGTATTCATGTGTTAAGTGCGAGAAGATGTTCAGTACACCCCATGGCCTGGAAGTTCACGCGAGAAGATCTCATAACGGCAAAAGACCCTTTGCTTGCGAACAATGCAGTAAGACATTCGGCCATGAAATCAGCTTGAGTCAACACAGGGCACTTCACAGCGTGGCGAAACTCTTCGAGTGCAAACAATGCGGGAAAACCTTCAAGAGATCGAGCACTCTCTCCACTCACCTGTTAATTCATTCCGACACCAGGCCATACCCTTGTCAGTACTGCGGAAAGAGATTCCACCAGAAATCTGATATGAAGAAACACACATACATACACACCGGTGAAAAGCCCCACAAGTGCCAGGTCTGCGGCAAAGCTTTCAGTCAAAGCTCGAATCTGATCACACATTCCCGCAAGCACACCGGCTTCAAGCCGTTCGCTTGCGAGCTTTGCGGGCGCGCTTTTCAACGAAAGGTCGACCTTCGCCGGCATAAAGAGACGCAGCATGCCAATTTGAGGGCGACCCAGCCTATGCAGCCTTCGCATACAGATGTTCACTCCATGCACTCAGATATGCAAATACCTGACCATAGAATAGATATCCGCCCTCATCCCGAGTTGCGGCCTCCGCACCCCGACTTCGGAGCGCCGCCACACATGACCACCGCAGTACCACCACTCCAGCCGTTGCCGTCCTGA
Protein
MKINGDLSKPSGGPRGRNFIQMKWKELTGILNSDSSGDPKSEDKWRKVWSDYKNNCKKKCAKINRAASGTGGGPALHLLLTDLEQRVMQIIGVQAATGMEIKEAGFPQEEISTERPNTEIILKEPEIDIDRKTREYASERDRVYEELERDRLRVREFEVRERVRQRDEELRMQGQWLEFMKEAMEAFVRNGDLSKPSGGPRGRNFIQMKWKELTGLLNSDSSGDPKSEDKWRKVWSDYKNNCKKKCAKINRAASGTGGGPALHLLLTDQEQRVMQIIGVQAATGMEIKEAGFPQEEISTEMPNTQIILKEPEIDWNAPSTSSQPTVAPPPPTEAPPPVINEEEEWNPPPQKKRKNNLTKIFLDIDRKAREHASERDRVYEELERDRLRVREFEVRERVRQRDEELRMQEKIKFGINRLVGDRTDEDEEELHNNETRAEGTSPASRCGSPCWAPSPQSPRSVRSSSPELEVDSPPSSPRRQPDSSPPPKRSEAFSVSALLRPDAPRVQPQRPFLYPPLPFAEFLRDAGGLGLHGWGGYSNLYLHAVQAAGPELLRLRAAVLGAPGPLTRPLPIGDVYSCVKCEKMFSTPHGLEVHARRSHNGKRPFACEQCSKTFGHEISLSQHRALHSVAKLFECKQCGKTFKRSSTLSTHLLIHSDTRPYPCQYCGKRFHQKSDMKKHTYIHTGEKPHKCQVCGKAFSQSSNLITHSRKHTGFKPFACELCGRAFQRKVDLRRHKETQHANLRATQPMQPSHTDVHSMHSDMQIPDHRIDIRPHPELRPPHPDFGAPPHMTTAVPPLQPLPS

Summary

Uniprot
ProteinModelPortal
PDB
2KMK     E-value=1.45948e-33,     Score=360

Ontologies

Topology

Length:
803
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04619
Exp number, first 60 AAs:
2e-05
Total prob of N-in:
0.00245
outside
1  -  803
 
 

Population Genetic Test Statistics

Pi
249.480805
Theta
204.676037
Tajima's D
0.267802
CLR
1.259109
CSRT
0.44292785360732
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号