SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01391
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.773
 

Sequence

CDS
ATGGTGGAGGCCCTTTCTAATTGGCCCCGCCACATGGCTGCCATTAGGGAGCGCCTAGGCCGCGCCCCCTCGGCGCGACCCTTCGGCACTGGTTTTAGGTTCCTGCCGTCGTCGGCTGAGGAATACAGGGCGGTCCAGGCCTACCTGTCGGAGGCCTCTGCCAGGGATAGTACCATTAAATGGTACTGCTATGCCCTGGCGGAGGAGATGCCCTCTAAGGTAGCTGTCCGGGGCCTCCCTGCCGACACCGACACGGCAGACGTTACCAACGCGTTGAAGGAGCTGGGGTTCCCGGCTCGATACGCTAGGTGCATTCGGTCCAAGAGAGGGCGACCGGGCAACGTGTTCCACGTTGCCCTGGATCACCTCTCAAAGGATGAACTCGCCCGCTTGTACTCAGTCAACGAACTGATGTACTTGCCGGGGGTGACGGTTGAGGGATGGCGACCAACCCGAGGGCCTGCGCAGTGTCACCGCTGCCAGGCCTACGGGCACGCCTCCCACAATTGTCACCGTGCGGTCCGCTGCGTGAGATGTGCTGCGGAGCACACTGTAGCGGACTGCCCGAGGCCGAGGGACGGCCCATTCTCCTGCGCCAATTGCGGGAAGGACCACGCCGCCGTTGATAGGCGGTGCCCGGTCTACCGCAAGAAGGCCAGGATGATGGGAGTAACCGTCCCTCCTCCGGTGCCACCGGTGCCACCGGTACGTCGATCCGGGAATGCAGCTCCTTCCGCTGTAGCACCCACCTCGAAGGGGAAGGGGAAGGGGAAAGGGAAATCTTCCCAGCCCCAACCCCCTCCCACGTCCTCATTCATCCCCCCTGCCGTCACAGTGGAGGCCGAACCATCGGCGGCAACGCTGATGGCTGAAGCCAACACTCCGCGGCGGGGTAAACCTACTCCGACCCCACGTAGCTTCGCTATAACAAGACCGACCCCAAAACAAGACCGCGCTCCGGCCCGTGCCGGTGCCCCAACCCCACAAGTAGCTCCAAACAAAAAAACCCTAAAGAATAGGAAAAAAAAGAGCAAAAGAAAAATGATGAAGAAAGCGCGAAGGGAAGCATTAGAGAACGCTGCTCCCTCGTCGGTTCCCGCAGTACCTGCCCTAGATATGGAGGTTGACCTTAACCCCACTATCGACCACATAATTGACGAACAGTCAATCCAGCAACCTGGACCATCTTCATTGCCCCAGGCCCAACCGGCCACTTCAGGCATACAGCCCCCATTACCACCCCGCCCGCAGAGGGAGCGGCGCAGCGGCCGACAGGACACGCAGCCTGCCGGCTTCGCTGCCTGGCTCCTCTCCCTGTGGGAGAAACTGTCCGAGGAGCTGCGCATCATCTACTGGAACCCCGACGGGATAGGGTCCCGGAGGTCGGAGCTCATCCGACTCGCCCAGGAGTATGACCCGCAGGTTATCCTCCTGGGCGAGACCAAGCTCAAACCTCGACAAGATTTTAGGATGCCCAACTACTTCGTGTACCGACGGGACGAACTGACCTCCAACGGGCGCCCGTTCAGGGGCACTGCGGCGCTCGTCAGGAGGGACGTGGTGCACGAGGAGCTTGAGCTACTGACCTTCGCCTCTACCAGAACGGTCGGGGTGAGGGTCCACGTACCGGGGGCCGAATTGCGGATTTATGCCGCGTATCGACCCCCGGGTCCTGATTTTGTCGAGGACGATATTAGACGGGCCTTGAACCATGATCGCCATCCGGCCTTGGTGGTCGGGGACCTCAATGCGAAACATGTCGCTTGGGGCTCCCGAATCATCACGCCGCCCGGAAGGCGATTGTACGAGGATGCCGAAAGGGGGGACTACTGCGTGGTCGGCCCCAACGAACCCACACACGTTCCAACGTTGGCCCGGTACCAACCGGACGTATTGGACGTGTGTGTTCACAAGGGGCTACAGTGCCCTCTAGCGATAGAGGCACTGTACGACCTGAGTACCCCTCACCTACCGATCTTGGTCACGGTGGGTTTGGGGCTCACTCGGGTCGCGACATCCCCTCTCAGGCCTAGGGTCGACTGGCAGTCCTTTACGGGACTGCTGGCCGACCAATCCTTGTTTCAAGACCCGTCTACCCCTGATGAGGTCGACACGGCGGCTTCCCGTCTCGTCGACACCATCAGGGGAGCCCTGGACCAAGTGACGACTCTGGTACCCAGCGGGGGGCCCAGAGCGGAACTCCCGGTGCACCTCAAGACGTTAATTCGTCGGAAGAGGGCACTGAGGAGGCTCTGGGCGACATCTAGGTGTCCCAGGATTAAGCGCGAGCTCAACCGACTTGAGGGGGAGCTGGCGACTAAGATGCGGACTTACCGGGGTGATTCCTGGGAGGGGGGACTGTTGGACGCGTCCGACGACCGTACGATGGCCCCCCTTCACCGCATCTGTCGCCGGCTCACCAACAAGCCTTCCCCCACTTGCCCCTTGGAGGACGAGGGGGGAAGACGGTGTTTTACACCGTTGGCTCGTGCCGAAGTCCTGGCCAACTCGCTGGAGCGGCAGTTCACTCCGAATGTCTCTGCACCCTCGATGGCTGCATTCCATCGCGAGGTGTCAGAGGGTGTAATCCACTTCCTCAAACCGGAATCGCCGGGAGTCGAGCTGGGAGATGGCGACTTAGTCACTCCCAGCGAGGTGCGCCTCCTCATCAAGTTGATGAAGAGGCGCAAAGCCCCCGGCGAGGACGGTATTCCTCCCCTCGCCCTGCAAAACCTCCCTCCCTCAATCGTGTCAGCAATGACACGATTGTTTAATTCCATTCTCCGGGTAGGACACTTCCCTGGAACTTGGAAACTGGGCAAGATCATCGTCTTGCCCAAACCCGGCAAGGACAGGAGAAAGCCCTCCAGTTACCGACCGATTACCTTGCTCTCGCACGTGGGCAAGTTGTTCGAGCGGCTGCTCCTGAGGAGAATATCGCCGTATATTCTCCTCAGGCCGGAGCAATTCGGCTTTAGAAGCGGCCACTCGACGACTCTGCAACTGACCCGTGTCCTGCATCACTTGGCGGACCGGCGAAACTCGGGCCAATACACGGTCGCGGTCCTCCTCGATATCGAGAAGGCCTTCGACCGTGTGTGGCACGAGGGGCTGGTCCACAAGCTGCGGGACGCGGGCCTACCGCACGCTCACGTGCGACTGCTCGGGTCGTATCTGGAGGGCAGAACCTTCTTTGTCGCGGTCGAGGGCGCACGGTCTTCCGTGCGTCCCATTACGGCCGGGGTTCCCCAGGGTAGTGTCCTATCACCTATCCTATACGCCCTCTACACCAATGACATCCCCACCCTGGAGGGTCACCTTCGGGTGTGGGAGGAGGACGTGAAGTTGGCCTTGTTCGCTGACGACTCGGCCTACTTCTCGTCCTCTCCGTTCCCCTCTGCAGCCATTATGAGGATGCAGAGGCTTTTGGATTTACTGCCCCAGTGGCTGGACCGTTGGAGAGTCGCGGTCAATGTGGGAAAGACCGCGGCCTTACTCTACGGTCCGGTCCGTATCAGAGTCGTCCCAAAGAAACTCAGCCTCCGAGGTGTGAATGTCGAGTTCAGGACCACGGTCCGGTATCTCGGATGCGACATCGACCGCTCCTTGAGCATGGTCGCGCACGTCAACCGAGTCATCGGTCAGACTCGCGCGGCCAGGTTCTTGTTGCGGCCGGTGTTTGCGTCCGGGCTTCCGACCAGGACCAAACTCGCCATTTACAAGACATACGTCCGTTCCCGCCTCACATACGCTGCTGCGGCCTGGTATCACCTGTTGTCGCCGTCCCAGCGATCTAGGTTGCAGGCCCAGCAGAGTCTTTCCCTCCGCATTATCGTCGGGGCCGGGCAGTACGTCAGAAATGACGTTATTGCCCGGGACCTAGGTGTGGAGTCGCTCGTGGAGTTTGTGACTAGGCTCGCCCGTAATATGTACGAGCGAGCCGAAAACGGGCCCCATGAGCATCTCCACAGCATAGCCCCGCTGCACGCCAGACCACCGGATGACGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGATCATCGAAACAAGTTGTAGTGCAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCTTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGCCCCTCAGGCCGACTCGCGGCGTTTGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGTCTCCTTGCCACCCTCGGATGCGTTACCACTCGTCACCCCGATGGAAGTTAAAGGCTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGATGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGTGAACTGTATCTTTCCAGCGGTGTGGAAAGAAGCGGATGTTATCGGCATACGTAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGCTTTATTCGCCGACGACACGACTGTTTACTATTCCAGTAAAAACAAGTCCCTAATCGCGAAGAAGCTTCAGAGTGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTTCTCCCGGATTAGGAGGATGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTTCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGAGACCCTCCAATCTCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATCCAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCACGCAGGAGCCAGTCACCGTCGACGCTCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGACGCCTTCAGCTCTAACACTAGGAGCAAGTTTAGGGACCCAGGTAACCGTACTCGCCGAACTTGA
Protein
MVEALSNWPRHMAAIRERLGRAPSARPFGTGFRFLPSSAEEYRAVQAYLSEASARDSTIKWYCYALAEEMPSKVAVRGLPADTDTADVTNALKELGFPARYARCIRSKRGRPGNVFHVALDHLSKDELARLYSVNELMYLPGVTVEGWRPTRGPAQCHRCQAYGHASHNCHRAVRCVRCAAEHTVADCPRPRDGPFSCANCGKDHAAVDRRCPVYRKKARMMGVTVPPPVPPVPPVRRSGNAAPSAVAPTSKGKGKGKGKSSQPQPPPTSSFIPPAVTVEAEPSAATLMAEANTPRRGKPTPTPRSFAITRPTPKQDRAPARAGAPTPQVAPNKKTLKNRKKKSKRKMMKKARREALENAAPSSVPAVPALDMEVDLNPTIDHIIDEQSIQQPGPSSLPQAQPATSGIQPPLPPRPQRERRSGRQDTQPAGFAAWLLSLWEKLSEELRIIYWNPDGIGSRRSELIRLAQEYDPQVILLGETKLKPRQDFRMPNYFVYRRDELTSNGRPFRGTAALVRRDVVHEELELLTFASTRTVGVRVHVPGAELRIYAAYRPPGPDFVEDDIRRALNHDRHPALVVGDLNAKHVAWGSRIITPPGRRLYEDAERGDYCVVGPNEPTHVPTLARYQPDVLDVCVHKGLQCPLAIEALYDLSTPHLPILVTVGLGLTRVATSPLRPRVDWQSFTGLLADQSLFQDPSTPDEVDTAASRLVDTIRGALDQVTTLVPSGGPRAELPVHLKTLIRRKRALRRLWATSRCPRIKRELNRLEGELATKMRTYRGDSWEGGLLDASDDRTMAPLHRICRRLTNKPSPTCPLEDEGGRRCFTPLARAEVLANSLERQFTPNVSAPSMAAFHREVSEGVIHFLKPESPGVELGDGDLVTPSEVRLLIKLMKRRKAPGEDGIPPLALQNLPPSIVSAMTRLFNSILRVGHFPGTWKLGKIIVLPKPGKDRRKPSSYRPITLLSHVGKLFERLLLRRISPYILLRPEQFGFRSGHSTTLQLTRVLHHLADRRNSGQYTVAVLLDIEKAFDRVWHEGLVHKLRDAGLPHAHVRLLGSYLEGRTFFVAVEGARSSVRPITAGVPQGSVLSPILYALYTNDIPTLEGHLRVWEEDVKLALFADDSAYFSSSPFPSAAIMRMQRLLDLLPQWLDRWRVAVNVGKTAALLYGPVRIRVVPKKLSLRGVNVEFRTTVRYLGCDIDRSLSMVAHVNRVIGQTRAARFLLRPVFASGLPTRTKLAIYKTYVRSRLTYAAAAWYHLLSPSQRSRLQAQQSLSLRIIVGAGQYVRNDVIARDLGVESLVEFVTRLARNMYERAENGPHEHLHSIAPLHARPPDDAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVVQDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRVSLPPSDALPLVTPMEVKGLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMVNCIFPAVWKEADVIGIRKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNALFADDTTVYYSSKNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRIFSRIRRMNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIETLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRSRHVLTDPSDPITFALDAFSSNTRSKFRDPGNRTRRT

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=1.47412e-05,     Score=122

Ontologies

GO

Topology

Length:
1971
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.48320000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1971
 
 

Population Genetic Test Statistics

Pi
340.158244
Theta
215.176563
Tajima's D
2.030541
CLR
0.206731
CSRT
0.88385580720964
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号