SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01372
Annotation
S08405_hypothetical_protein_2_-_silkworm_transposon_mag
Location in the cell
Nuclear   Reliability : 2.167
 

Sequence

CDS
ATGGGTGAGGAAGCGTACGATTTATTATCGACATTAGCCAGCCCTTCGAAGCCGTCACAATTAACATATGCTAATGCTGTAGCGATGTTGGCAGCTCACCTGCAACCGAAGCCCTCAATCTTGGCGGAAAGATACAAGTTTCGACAACGTCGGCAGCTGAATGAGTCAATAGCTGACTACCTCACAGAATTAAAAAAAATATCAAAAAATTGTGAATTCGGCTCGTCGCTGGATGAAAATCTGCGTGATCAAATGGTTTGTGGATTAAAGAGCGAAATCATACGGCAAAGGTTATTTGCCGAGGAGAAATTAGAATATAAGCGTGCAGTTACGTTAGCTTTGTCATTAGAAGCTGCGGAGAGGGATGCGATTGCAGTGGAACGTACGCCAATTGAGGAGGTTAACAAAATTAACTTCAATGAATGTTCAAGATGTGGAGACAGGAGACACCAAGCAAAGGATTGCATATACAAAGACTACGTGTGCAGTTCATGTCATGAAACCGGCCATCTACGAAGAATGTGCCCCAAAAACGGGCTTAAGAACCAGGCGGAGGCAGCCGGGGGTTCAGCACGCACCGGGCGCCGGGGGAACCGGGGTGCAGGCGGCAACAGGCGATCGTGGCGCGGGCAGCGCGGTGCGGGACGAGGAGGCCGAGAGCGGGCTCCTTTGCACTTATTATACGATCAAAACAACGATGACACATACAACAACTTCAATAATGAACAGGACGGGTGTGGAGAAGAAAATGAGCCTATGTACCAAATGACATTGAGTAATTATAAACCGGTGTGTATTAAAGTTAAAGTCCAAAATTGCTTGCTCAAGATGGAGGTCGATACTGGATCGGCGTTATCTTGTATTAGCAAGAATGTTTATGATAAATATTTTTCTAAGGAGAAGTTACAGGCATGCTTATTAAATTTAAAATTTTACGATGGCTCAATCATTCGGCCTTTAGGGTTTATAAACACTATAGTGAAGTACCAAGGTGTTTCAAAAATGTTAGACTTGTATGTCATAGACAAAGGAACGACTAATCTATTGGGCCGACAATGGTTAGCTGAATTGAATATTAATATAAAAATATCAAAACCTACGAGTTTTAAAATACAACACAGTAACTTTGTAACCGAACACGCACGAGACTATAATAAATTAATTAATGAAATTGTTTCTAGACATAAATCCTTGTTCGACGGCACATTGGGTAAATATACGGGGGGCACAGCAGAGTTAATCGTGCGGCCGGATGCGGTGCCTATCTACTGCCGCGCGCGACCGCTGCCGTATGCGCTGCGCGAGCGCGTCGATGCCGAGCTCGACGCGATGCTGGCCGCCGGCGTCATCAAACCGGTGGACCACTCCGACTGGGCCACGCCACTTGTCGTAGTACGCAAAGCGGACGGCGGTCTGAGAATATGTGCGGACTATAAGGTAACCCTTAACAAAGTATTAGCAATCGACAGATTTCCGGTTCCAAAAATGGAGGACTTATTCAGTAATCTCAGCGGAAATAAATTTTTTACTAAGCTTGATTTATCTCAAGCTTATAATCAAATAGTCTTATCAGAACGTTCTAGCGAGTACACGGTTATCAATACACATAGAGGATTATTTAAATATTCCCGCCTCGTCTACGGGTTAGCTTCGAGCCCAGGCATTTTTCAAAAACTAATGGTAAATATGTTTAAAAATGTCCCAAATGTAGTAGTTTTCTATGATGACATATTGATTAGAAATCAGGACCTAGACAGTCATTTAAAGTCTATAAAAGAAGTATTAGATATATTAGAAAGGTATGGCTTAAAAATTAAAAGGAGTAAGTGCGAGTTCATGGTAACAGAAGTGAGGTATTTAGGGTTCATAATAGATCAAAATGGGGTTCGTGTAGACCCAGAGAAAGTCAAATCAATAGCAACAATGCCACACCCAAATAACGTGACAGAATTAAAATCTTTCATCGGTATGGTAAACTTCTATTCGAAGTTCATACAAGATTTGAGTGCACATTTATCACCTTTATATGCCCTTTTAAAAAAAGGTAAGCACTGGATGTGGGGAAATGAACAGAATGCTGCTTTCCTGAATGTTAAAAAGTTTTTGTGTAGTACAAAAGCACTCGCACATTTTGATATGTCTTTGGAGTCGGTGTTGACTGTGGATGCGAGCGCGCGTGGTCTGGGTGCCGTGTTGGCGCAGCGCGGGCCAGGATGTCAGGAGCGCGTCGTTGCATACGCTTCACGCGCACTCACCACTCATGAATTACACTACAGTCAGATTCATAAGGAAGCATTGGCGATTGTTTTCGCGGTGGAAAAATTCCATCAATACTTATATGGGAGAAAGTTCATACTACGGACCGACCACAAACCTCTGGTGAGCATTTTCGGGCCTAACATAGGTATCCCGAGCGCGGCAGCTAGCCGCTTGCAGCGCTGGGCTATTAAACTATCAGCATATGACTTTGAAATCGAGTACGTTAGGACAGATAAAAATGTAGCCGATGCACTTTCACGGTTAATCGAGTCTCAAAAAAATGACGTAGCTTCCGAGGAAACAGACTTACCCGAGCAAACCTACTTACACTTCTCAACAGAAGCTCTGTTAATAGATTATAATGTTCTTAAAAAACAAACTAGTAGTGATCCAATCTTAAGTCGCGTATTAAGTTATTTAAGGGACGGATGGCCCTTAGACATAGAAATTAATGAATTAAAACCATATTATAATAGGAAAAACGAACTTTATATTGAATTAGGATGTATAATGTGGGGTCATCGTGTGGTTATACCCTCTTCATGCAGAAACAAAATAATAACGGAGCTTCATGATCCGCATATGGGCATAGTGAAAACAAAATCGCTAGCACGTAGTTACGTTTGGTGGCCGGGAATCGACGAAGCGCTCGAGACGGAATGTCGCGCTTGCACCGTGTGTGCTGCCGTCGCAGACGCACCTTCTACACACGCGCCCCGCTCGTGGCCCTGGCCCTCACGCCCCTGGTCCAGGTTACACTTAGACTTCTTAGGCCCCATAGGTGGAGTCACTTACCTAGTTGTAGTGGATTCATGCTCCAAATGGATAGAGGCAATTAAAATGCAGAGGACAACGGCACAAGCGGTTATATCGGTACTGCGGGACTTGTGGTCAAAATTCGGCCTGCCAAAGCAAACGGTCAGTGACAATGGACCGCCTTTCTCGAGCTCTGATTTTCAGAAGTTTCTGATTCATAATGGCATAAAACATATTTATTCAGCTCCCTATCATCCCGCCTCTAATGGGGCCGCTGAAAATGCAGTTAAAATTTGTAAACGTGCGATTAAAAAGGCATTAAAACAGAATTTAAACGTAGATACAGCTCTGTGTAGATTTTTATTAGCCTACAGAAATACAGAACATGCAACTACCGGCGATAGTCCAGCCAATATATTACAGGGTCGAAGTCTCCGTATGAGATTAGATAATTTAAAACCAGAAAGGCAATCTCGAGTTATCGCGCAACAAGAGCGGAGCGAGCAAAACGCAGGGGGTGTGCAGCGACAACTCGAGCCGGGCACTAAGGTGTGGTATCGGGATTATCGAGGTCTGGATAAATGGGTACCTGGGACGATCCTCAAGCAATTAGGTAGTCGTGATTACTGTGTACGATCTAGTTTTGGAACCGAGAATCATAGGCACGTCGATCAGCTAAAATTAAGGGTTACAAAAAATATAGATAAAGTTGATACCTTTGCGTCGATTCGTAAAAATATAAGTCCCGAACTGATCGCGCAAAATTTAGACTTAAGAACACAATCACGTAAGTCGCTATCATTTCCCATGACAAGTGGCGAGGAACCAGTGGCGGTGGTCAACGATTCGGGGAAGAGTAGTTCACCACCAAAAAATAGCACACCGGCACAGGATGCTGTATCGCCTATTCGTGGCAGCCCTATGAGACCCGCTGTGCCGATAGACAAGGGAGCATGTAATACTGGTGGTAAGAGTATCAATGAAAATGTGACACCCAAACGTGAACGTCCTGTAAGAATACGCAAGCCACCAGTTAGATATGGATTCGAGGAAATAGATTAA
Protein
MGEEAYDLLSTLASPSKPSQLTYANAVAMLAAHLQPKPSILAERYKFRQRRQLNESIADYLTELKKISKNCEFGSSLDENLRDQMVCGLKSEIIRQRLFAEEKLEYKRAVTLALSLEAAERDAIAVERTPIEEVNKINFNECSRCGDRRHQAKDCIYKDYVCSSCHETGHLRRMCPKNGLKNQAEAAGGSARTGRRGNRGAGGNRRSWRGQRGAGRGGRERAPLHLLYDQNNDDTYNNFNNEQDGCGEENEPMYQMTLSNYKPVCIKVKVQNCLLKMEVDTGSALSCISKNVYDKYFSKEKLQACLLNLKFYDGSIIRPLGFINTIVKYQGVSKMLDLYVIDKGTTNLLGRQWLAELNINIKISKPTSFKIQHSNFVTEHARDYNKLINEIVSRHKSLFDGTLGKYTGGTAELIVRPDAVPIYCRARPLPYALRERVDAELDAMLAAGVIKPVDHSDWATPLVVVRKADGGLRICADYKVTLNKVLAIDRFPVPKMEDLFSNLSGNKFFTKLDLSQAYNQIVLSERSSEYTVINTHRGLFKYSRLVYGLASSPGIFQKLMVNMFKNVPNVVVFYDDILIRNQDLDSHLKSIKEVLDILERYGLKIKRSKCEFMVTEVRYLGFIIDQNGVRVDPEKVKSIATMPHPNNVTELKSFIGMVNFYSKFIQDLSAHLSPLYALLKKGKHWMWGNEQNAAFLNVKKFLCSTKALAHFDMSLESVLTVDASARGLGAVLAQRGPGCQERVVAYASRALTTHELHYSQIHKEALAIVFAVEKFHQYLYGRKFILRTDHKPLVSIFGPNIGIPSAAASRLQRWAIKLSAYDFEIEYVRTDKNVADALSRLIESQKNDVASEETDLPEQTYLHFSTEALLIDYNVLKKQTSSDPILSRVLSYLRDGWPLDIEINELKPYYNRKNELYIELGCIMWGHRVVIPSSCRNKIITELHDPHMGIVKTKSLARSYVWWPGIDEALETECRACTVCAAVADAPSTHAPRSWPWPSRPWSRLHLDFLGPIGGVTYLVVVDSCSKWIEAIKMQRTTAQAVISVLRDLWSKFGLPKQTVSDNGPPFSSSDFQKFLIHNGIKHIYSAPYHPASNGAAENAVKICKRAIKKALKQNLNVDTALCRFLLAYRNTEHATTGDSPANILQGRSLRMRLDNLKPERQSRVIAQQERSEQNAGGVQRQLEPGTKVWYRDYRGLDKWVPGTILKQLGSRDYCVRSSFGTENHRHVDQLKLRVTKNIDKVDTFASIRKNISPELIAQNLDLRTQSRKSLSFPMTSGEEPVAVVNDSGKSSSPPKNSTPAQDAVSPIRGSPMRPAVPIDKGACNTGGKSINENVTPKRERPVRIRKPPVRYGFEEID

Summary

EMBL
HADX01010638    SBP32870.1    GECU01037588    JAS70118.1    HADW01008367    SBP09767.1    + More
GEZM01001427    JAV97782.1    GEFM01006397    JAP69399.1    GEDC01007675    GEDC01003661    JAS29623.1    JAS33637.1    GGMR01020219    MBY32838.1    GEZM01030100    JAV85808.1    GCES01042893    JAR43430.1    GCES01151725    JAQ34597.1    GEDC01023506    GEDC01023205    JAS13792.1    JAS14093.1    GDHC01002706    JAQ15923.1    GEZM01092768    GEZM01092767    JAV56467.1    GCES01009650    JAR76673.1    AB126055    BAD86655.1    HAAD01006009    CDG72241.1    GEDV01006828    JAP81729.1    NIVC01003024    PAA53787.1    EF199621    ABM90392.1    NIVC01001899    PAA62793.1    EF199622    ABM90393.1    GEZM01050895    JAV75318.1    GEZM01050896    JAV75317.1    UYSL01002587    VDL65922.1    NIVC01001652    PAA65446.1    GEZM01014356    JAV92133.1    GFXV01004590    MBW16395.1    GBHO01027669    GBHO01027668    JAG15935.1    JAG15936.1    GEZM01009753    JAV94337.1    GEZM01085308    JAV60010.1    GEZM01009754    JAV94336.1    AZHX01001899    ETW98900.1    GBHO01042583    JAG01021.1    GBHO01027659    JAG15945.1    KL363264    KFD49780.1    JYDO01000093    KRZ71620.1    GGMR01010825    MBY23444.1    GBIH01000761    JAC93949.1    JYDP01000327    KRZ01162.1    MRZV01000143    PIK57404.1    KL367504    KFD68531.1    NIVC01001377    PAA68677.1    NIVC01000264    PAA86792.1    NIVC01001308    PAA69606.1    JYDO01000377    KRZ65389.1    GGMR01017626    MBY30245.1    GEGO01004800    JAR90604.1    NIVC01000860    PAA75827.1    AAZX01023237    ABLF02065955    GEHC01000992    JAV46653.1    GEGO01004533    JAR90871.1    ABLF02010224    JYDL01000080    KRX17894.1    GL379789    EGT45549.1    GL379857    EGT56876.1    GGLE01005288    MBY09414.1    GEGO01004875    JAR90529.1    GEDV01003323    JAP85234.1    JYDH01000010    KRY40903.1    PDUG01000024    PIC12319.1    GEGO01004812    JAR90592.1    GEZM01002003    JAV97411.1    GALX01005032    JAB63434.1    PDUG01000006    PIC22136.1    DS268431    EFO96847.1    PDUG01000002    PIC45869.1   
Pfam
PF17921   Integrase_H2C2        + More
PF00665   rve
PF17917   RT_RNaseH
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF00098   zf-CCHC
PF00077   RVP
PF03732   Retrotrans_gag
Interpro
IPR001584   Integrase_cat-core        + More
IPR001995   Peptidase_A2_cat       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR041373   RT_RNaseH       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR041577   RT_RNaseH_2       
IPR001969   Aspartic_peptidase_AS       
IPR018061   Retropepsins       
IPR034128   K02A2.6-like       
IPR005162   Retrotrans_gag_dom       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=3.14764e-58,     Score=575

Ontologies

Topology

Length:
1358
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0133
Exp number, first 60 AAs:
0.00464
Total prob of N-in:
0.00025
outside
1  -  1358
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.900679
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号