SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01219
Pre Gene Modal
BGIBMGA008808
Annotation
PREDICTED:_ras-responsive_element-binding_protein_1_[Papilio_polytes]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.162
 

Sequence

CDS
ATGTCTGAGAACGGTGGAACAGCAGTATCAAGATCCTCCACACCTCATCCAGTGACCGAAGCACAAGCCAATGCTCCCCTGCGGTCGAGACATGATCAGTTTCTCGCTAGTACCACTGAACGCACGCAGCAAAGGCAATCTTCCAGCGGCAGAAATCCAAGTGTCAGCTTCGAGTCTCCACCACTGCCTTACCATAGGCAGATAGCTACCGGGTCCTTACTAACGTCATCCCATCGAGAATCATCAGCTTTTGTACCGGTGGTACCAACAAGATCGATGCATCCTGTCATGTATCCTAGCGAGATGCATCCAGCATTGATACCGTCTGAAATAATAGAGAGAGAACGTATGCTAGATAGAGAAAGAAACGAACCAGCGAAAGGCTCACCGGATAGAGCTCCAGCAAGCTTTCCCAAAAGAAGCTCGTTCGATTTAATGGCTATGATGGTTGAAAAAAGAAAAGAGGTGGCACTACGAGAAGCTGCAGCGGCAATGCTACTCCCTCATCACAGAGCATCGTCAATGGACGGTATGATGTCTGATGGGTCTCCGCAACCTCCGATTTACGGGCCTCCCGGTGCGTTCCTTGGAGCGCCGGGTCCTTCTCCGACAGCTGCTGGAAACTTTACATTTCCTGGAGCGGGTCTATTCCCACCTAATGCCGGGCCGCACCAGATCCATCCGTTAGACCGTAGGTTGCTGAGAGCGCCTGGCCGAGCTTCGCGGCCGAAGAAACAATTCATTTGTAAATTTTGCAACCGACAATTTACGAAATCCTACAACCTACTCATCCACGAGAGAACCCATACAGACGAGCGGCCGTATTCCTGTGATATCTGCGGAAAGGCATTCAGAAGACAAGACCACTTACGAGACCATCGGTACATACACTCCAAAGAGAAGCCTTTCAAATGCACAGAATGTGGCAAAGGTTTTTGCCAGTCGAGGACGTTGGCCGTTCACAAAATTCTACACATGGAAGAGTCACCACACAAATGTCCAGTTTGCAGCAGAAGCTTCAACCAACGATCCAATTTGAAGACACATCTATTAACACACACAGACCATAAACCTTATGAATGCAATTCATGTGGGAAAGTGTTCAGACGTAACTGTGATCTTCGGAGACATGCACTTACTCATGCAGTCGGTGACGTACCACCGGGAGATGTGCTAGACGTAGGCGAAGAAGACATCGGAAGACCAGGATCTCCCATTGAACCGGGCTATGATGATGAAGATGCCGAAATTTCATCACCTGAACACTCCCCAGTGCGGAGAGCAAGATCTTCATCAGTGGAAAGCATTGGACAAGAACCACAAAGTGAGGAAAAACCACGACGGCAATCGCCAACACCTGTAGAACGCACCCATTGTCATCACAATGAGCAAAGGGACAGAGCAAGCCCATACACAATGCGTCCACAACACACAGACAAACATCGAGCTTACTCATCAGATGAATACGAAAAACGTCGATACACTACTGAGGAAATAATGGAAAAAGAAATGCGCTACACAGAGATTCCTGAACAACAAGTACGGCATCCACAATTACAAATCAGACGAGATTTACACCAGATTCCTCCTCCAGATCCGTCCAAAATGACTCAAATTACAAGTCCGTCCATTGATCCGGGACCTTCTAATATGTACTTGCCTCCATTTAGAAAGAGAAGTCACCCACCAGATATCGGAGATAATCCAAGGTCATGTGCTGCAGTTTACAGAAGCAGATCACCGGAGCCAACCAATCTCACAATGCCTCGGCCTCCAATAGGAAATGGGGAAATGGTAGTCGGTATAGCTCCTACACTTATGGGAATGCCGGCATATCATAAATTTGGATTACCGATGCCACCTCCTCACCCGCAAATCGCATACGGTCCAGTGCCTCACCCTGTTTTGGCACCACAACAAACTGTCGCTCAAGACTTGATTGTTAAGCATGCGCCGCCGAAGGACACAATACCTTCAACGTCCACTATAGTTACGAACTGCAAAGATGCAGGTACAAGCATGAAGGATGCAGAGGAATCAAGTTCGTCTTACATAGCGAGTGGCATTAAAAATATCATTGGTATTCAACCGCCGGCCAATCCAAGCCGGGGACAAGCGGATCCAGTGGACCGAAAAAAGGTTTCAGTATAG
Protein
MSENGGTAVSRSSTPHPVTEAQANAPLRSRHDQFLASTTERTQQRQSSSGRNPSVSFESPPLPYHRQIATGSLLTSSHRESSAFVPVVPTRSMHPVMYPSEMHPALIPSEIIERERMLDRERNEPAKGSPDRAPASFPKRSSFDLMAMMVEKRKEVALREAAAAMLLPHHRASSMDGMMSDGSPQPPIYGPPGAFLGAPGPSPTAAGNFTFPGAGLFPPNAGPHQIHPLDRRLLRAPGRASRPKKQFICKFCNRQFTKSYNLLIHERTHTDERPYSCDICGKAFRRQDHLRDHRYIHSKEKPFKCTECGKGFCQSRTLAVHKILHMEESPHKCPVCSRSFNQRSNLKTHLLTHTDHKPYECNSCGKVFRRNCDLRRHALTHAVGDVPPGDVLDVGEEDIGRPGSPIEPGYDDEDAEISSPEHSPVRRARSSSVESIGQEPQSEEKPRRQSPTPVERTHCHHNEQRDRASPYTMRPQHTDKHRAYSSDEYEKRRYTTEEIMEKEMRYTEIPEQQVRHPQLQIRRDLHQIPPPDPSKMTQITSPSIDPGPSNMYLPPFRKRSHPPDIGDNPRSCAAVYRSRSPEPTNLTMPRPPIGNGEMVVGIAPTLMGMPAYHKFGLPMPPPHPQIAYGPVPHPVLAPQQTVAQDLIVKHAPPKDTIPSTSTIVTNCKDAGTSMKDAEESSSSYIASGIKNIIGIQPPANPSRGQADPVDRKKVSV

Summary

Pfam
PF00096   zf-C2H2
Interpro
IPR013087   Znf_C2H2_type        + More
IPR036236   Znf_C2H2_sf       
SUPFAM
SSF57667   SSF57667       
PDB
2EE8     E-value=1.04254e-38,     Score=404

Ontologies

Topology

Length:
716
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00657
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00021
outside
1  -  716
 
 

Population Genetic Test Statistics

Pi
256.256638
Theta
184.975907
Tajima's D
1.853077
CLR
0.213316
CSRT
0.853757312134393
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号