SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO01067
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.533 Nuclear   Reliability : 2.066
 

Sequence

CDS
ATGACGACACCAGGAGTTTCGGCAACTCAACTAGCATTATCGCAGACTTCAGCGGACATTATGGCGATCTCGCTATCGACACGTATACCAGAATTTTGGACAGAGCAACCAAGAGCATGGTACATTAGGATCGAGTCTATACTCGCCCCACAGAAACTTGGGGATGAAGTTAAATTTGACATTGTCGTATCGAAATTACCAAAAGAAGTCATTATTCAACTAACGGATTTTCTAGCTAAGCCACCGGACACAGGAAAATTTCTGGCGTTAAAAACGAAATTATTATCAACATTTGAGGAGTCCAAAAGTCGACAAATTGAAAGACTCATAGGAGAGATGGAACTAGGAGATCAAAAACCTTCTCAGCTATTGCGCCGCATGAGAGAGTTAGCCAGAGATAAAGTACCGGACGACACCCTGCGAGTGTTATGGCAAGGTCACTTACCTACAACATTGAGGGCAATCCTTACAGTCACTGAAACAAAAGATTTAGACAACCTCGCCATGATTGCGGATAATGTTGCGGAGGCCACGCGAGTTAACCACATCTCTGAGGTCGTTAATCAGCAAACCTCGAATATGGAACGACCATCAACAAGCGACACGTCTTTAATTTTAGCGGAAATAGCAAAATTAAGCGTCAGAATGACTAACATGGAGCAGTCACGATCCAGACAAAACTACTTTGATCGTAACCGTGATAGAAGTGGCTCACGATCTTCATCAAGACGCCGTACCCCACAGAACCCCAACTGGTTATGTGCTAATATTTCAGTTTTACCGGTGCCTAAAATAAGTAAATTTATCAAAAATCCTAACTATAAGTTATATGCAGCCAATGGAACTGAAATTGCAACATTTGGTGAAAAAACGTTAGTGCTAGATTTGAAGCTACGTCGCGCTTTCCGATGGAACTTCGTGCTTGCAGATGTTAAACAGGCTATATTAGGGGCGGACTTTTTAACTTCTAACAATCTTTTGGTTGATATGGGTGAACGTAAGCTTATCGATAAGGTAACAGATCTGAATGTATTAGCTTGTATTGTTGTTAGCAATCAACCTTCATTGCATACTGTTGATGTGAGTCATCCATATCGTGATTTGTTAGCGCAGTACCCCGACATTACGAAACCAGCGTCATTTAAGGAAGTAAGTTCTCATAACGTTTTGCATTATATTGAAACTACTGGTCCACCGGTGCATGCTCGTGCTCGACCACTGGCACCTGAGAGATATAAAATAATTAAGGAGGAATTTCGGATCATGCAGGAATTGGGTATTTGTCGGCCTTCTAAAAGTGCTTGGGCTAGCCCGTTACATATTGTCCCCAAGAAAAATGGAGACTTAAGACCATGTGGTGATTATCGTCAATTGAACGCTATTACAAAACCTGACAGATACCCTATTCCTCGACTGCATGATTTTACTTATATTTTGGCTGATAAAAAGATATTTTCAAAATTAGATATCAATAGAGCATTTCATTGTATTGATGTTGCTCCTGAAGATATTGAAAAGACTGCCATAATAACGCCTTTCGGTCTTTTTGAATTTCCTAAAATGACATTTGGTTTGCGGAATGCGCCACAAACATTCCAACGCTTTATGAATAACACTGTCCTACAAGGCCTTGAATTCCTATTCAGTTATCTCGATGACTTTAAACGTATTGCATTTGAGAGCCTACATAATTTAAGCCACCCAGTGCAGGAGACCCTACTTAAGCCCGCGCGCCGTGACCCTAAAATCGCGAACTATAACATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGTTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCTCACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATGATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAGCATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MTTPGVSATQLALSQTSADIMAISLSTRIPEFWTEQPRAWYIRIESILAPQKLGDEVKFDIVVSKLPKEVIIQLTDFLAKPPDTGKFLALKTKLLSTFEESKSRQIERLIGEMELGDQKPSQLLRRMRELARDKVPDDTLRVLWQGHLPTTLRAILTVTETKDLDNLAMIADNVAEATRVNHISEVVNQQTSNMERPSTSDTSLILAEIAKLSVRMTNMEQSRSRQNYFDRNRDRSGSRSSSRRRTPQNPNWLCANISVLPVPKISKFIKNPNYKLYAANGTEIATFGEKTLVLDLKLRRAFRWNFVLADVKQAILGADFLTSNNLLVDMGERKLIDKVTDLNVLACIVVSNQPSLHTVDVSHPYRDLLAQYPDITKPASFKEVSSHNVLHYIETTGPPVHARARPLAPERYKIIKEEFRIMQELGICRPSKSAWASPLHIVPKKNGDLRPCGDYRQLNAITKPDRYPIPRLHDFTYILADKKIFSKLDINRAFHCIDVAPEDIEKTAIITPFGLFEFPKMTFGLRNAPQTFQRFMNNTVLQGLEFLFSYLDDFKRIAFESLHNLSHPVQETLLKPARRDPKIANYNMVRNDRLSARGGGTVIYYRRALHCVPLDPPALVNIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNDPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFSMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGNRTRRTRQRGRRAT

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=4.79222e-24,     Score=281

Ontologies

GO

Topology

Length:
1468
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
4.22101999999998
Exp number, first 60 AAs:
0.00444
Total prob of N-in:
0.00032
outside
1  -  1468
 
 

Population Genetic Test Statistics

Pi
26.26977
Theta
29.757582
Tajima's D
2.21618
CLR
0.359999
CSRT
0.91720413979301
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号