SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00977
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.329
 

Sequence

CDS
ATGGACGCTGTATTCGAGGAAATCCTCCGACTTCGCCACCCACAGCTCGCCTCAGAGTTTCTGGCCTTCAAGGCCAATCACACTGCGAGCCCTCTCGAGGACCCCGCCGCGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAAAGCTTCTGCATTGAGCACCGCAGCCACCGTCGTGCCTGCCGTTCCCGTGTCGCCTATACTGGCGAGTAAAGCTGCTGCGTCGTCCGCCGTGACCACCGTTTCAGCTGAGCGATCATCCGCGGCCTCCGTCGTGCCCTCTAAAACACCTACACTTGCTCGTAGGTCGCCTGCGCCCTCCTCCTCGTGCTCCGACTCTGACTCGGACATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGGATTCACCCTGGTACAGAAGGGTAAGAAGCGTGCCGCGGAGTCCCGAGCTCCCGCGGCCGCTAAAATTAGCAAAACCGCGAACGCGTCGCGCCCCCGCCTTCAGACTCCCGTTGCGCCCCCAGCCCGTGCCACTCCGTCGCCGCGTCCGGTGGCACAAAATAAAACCGCTCCCCCGGTTATCCTTCAGGAGAAGGCAACTTGGGATCGAGTTTGCCTGGCCCTTAAGGCCAAAAATATCAATTTCACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCAAACACCCGACGACCATAGGGCCTTCTCTTCTTACCTCTGTAAGGAGCGTATAAGTTTCCATACGTATACGCTCCAGGAGGAGCGCGAACTCCGCGTTGTAATACGCGGAATCCCTAAAGAGTTAGATGTAGAGCTCGTCAAGGCCGATCTGTTAAAACAGGGCTTACCAGTGAATTCTGTGCACCGTATGCACACCGGTCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCCCTTCCAGCCTACCCCCGAGGGGAACTCCTTAGAGCTAAGAACGCCTCGATACACGCCTACGACAGGTATCCTACCGTGGATAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACCCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGTAA
Protein
MDAVFEEILRLRHPQLASEFLAFKANHTASPLEDPAALAAPASPVPACKASALSTAATVVPAVPVSPILASKAAASSAVTTVSAERSSAASVVPSKTPTLARRSPAPSSSCSDSDSDMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKTANASRPRLQTPVAPPARATPSPRPVAQNKTAPPVILQEKATWDRVCLALKAKNINFTNARNLANGIQIKVQTPDDHRAFSSYLCKERISFHTYTLQEERELRVVIRGIPKELDVELVKADLLKQGLPVNSVHRMHTGRGREPYNMVLVALPAYPRGELLRAKNASIHAYDRYPTVDNRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTL

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
410
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00556999999999999
Exp number, first 60 AAs:
0.00183
Total prob of N-in:
0.00321
outside
1  -  410
 
 

Population Genetic Test Statistics

Pi
4.359628
Theta
1.616463
Tajima's D
3.809297
CLR
0.265009
CSRT
0.998850057497125
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号