SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00955
Pre Gene Modal
BGIBMGA009809
Annotation
PREDICTED:_mucin-2_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 1.874
 

Sequence

CDS
ATGTTAAGCCAGATTATGTACAAAGCGATAATATTCCTGACACTAATTGCTGCGTCATCGGCCCAGTATCTACCGAACGGCTGCCCCTCAAACTTCCACATCCACCTGCTGCTCCCCCACGAAACGGACTGCTCCAAGTTCTACTCATGCAGCAACGGTAGGAAGGTTCTGCAGGCGTGCGCTGGTGGTACGCTCTTCGATTTCAAAGCTCAGATCTGTAACTGGCCATCAGCAGTGAATTGCACAACAAGGCCACCAGCACCCGAGGTCACCACACACCCTGCACCAGTACCAACCCAACCACCGACAGTTCCACCTGAGACCGTGCCACCCACAACGACACCACCCGTGACGTCACCAGCCCCCACGTCACCACCTGGTTCCGACTTCCTGCCAAACGGCTGTCCTAAAGACATCCACGTGCATTGGTTGGTCCCGCACGAGTATGACTGCACGAAGTTCTACCAGTGCACACACGGGAACCTGGTGCTCAAGACTTGCAGTGGAGGACTGTACTTCGATTTCGCTTTACAGGTCTGCAATTGGCCTTTCATGGTCAACTGCACAACCAGTACAACACTCAGCCCGACCACCGCCAGTCCCACCGAGACCACACCCATCGTGACGTCACCCAGCGCAACCACACCCAGTCCTGCCCCAGTCACGACTCCCAGTACCACAACCACAAGGCCGCCTACCACCGAAGGCGCCTTCCTGCCGAACGGCTGCCCTGCCGACTTCCACGTGCACCTCCTCCTGCCCCACGAGACGGACTGCACCAAATTCTACTACTGCGCTCACGGCGAGAAAGTATTGAGACAATGCGGCCCTAACACGGCATTCAATTTTGAATTACAGGTTTGCGATTGGTATTTCAACGTGAACTGCACGATCCCTGACGCGACCACCGAGGGACCGCCTTCGTCGACTCCAACAACCGTACCAACAACTACAGAAGACGTGCTAACAACATATGACCCTAAAACCACAACACTACAACCTATATTTACAACTGATATTGTTGAAACAACCACCGCTGACGATGGTGGAGAAGACGGTGATGTCACTACCACTACAGAGAGCAGTATTACAACTCATTTACCCACAGTGGTACCGACCACTACTACGGAGCTACCGACTACAGTGACTACAGAAGGTACCACTACAAAACTGCCCACTACAGTAACTACAGAAGGTACCACTAACACAGAACTACCGACTACAATAACTACAGAGGGTACCACAACTACAGAACTACCGACTACAATAACTACAGAAGGTATAACTACAACAGAGCTACCCACTACAATAACTACAGAAGGTACAACTACAACAGAGCTACCGACTACAATAACTACAGAGGGTACAATTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAAGTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGATCTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAATCACTACAGTAGGTACCACTACCACAGAACTACCGACTACAATAACTACAGAGGGTACAACTACGACAGAGCTACCTACAACAATCACTACAGAAGGTACCACTACCACAGAGCTACCTACAATCGTCACTACAGAAGGTACCACAACTACAGAAGTACCGACTACAATAACTACAGAAGGTACAACTACAACAGAGCTACCTACAACGGTCACTACAGAAGGTACCACTACCACAGAAGTACCGACTACAATAACTACAGAAGGTACAACTACAACAGAGCTACCTACAACCGTCACTACAGAAGGTACCACAACTACAGAACTACCGACTACGATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAAGTACCGACTACAATAACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACAACTACAGAACTACCGACTACGATAACTACAGAGGGTACAACTATAACAGAGCTACCTACAACAGTCACTACAGAAAGTACCACAATTACAGAGCTACCTACTACAGTCACTACAGAAGGTACCACAACTACAGAAGTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCTTTACAGAAAGTACCACAATTACAGAGCTACCTACTACAATCACTACAGAAGGTACCACAACTACAGAACTACCGAGTACAATAACTACAGAAGGTATAACTACAACAGAGTTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCGACTACAATAACTACAGAGGGTACAACTACAACCGAGTTACTTACGACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCCACTACAATAACTACAGAAGGTACAACTACAACAGAGCTACCCACTACAATAACTACAGAAGGTACAACTACAACAGAGCTACCCACTACAATAACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCCACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGGACCATTACCACAGAGCTACCTACTACAATCACTACAGAAGGTACCACTACCACAGAACTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAAGTACCGACTACAATAGCTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCTACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGGACCACTACCACAGAGCTACCTACTACAATCACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACTGAACTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCATTACAGAAGGGACCACTACCACAGAGCTACCTACTACAATAACTACAGAGGGTACAATTACAACAGAGCTACCTACAACAGTCACTACAGAAGGGACCACTACCACAGAGCTACCTACTACAATCACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACTGAACTACCGACTACAATAACTACAGACGGTACAACTACAACAGAGCTACCTACAACAGTCATTACAGAAGGGACCACTACCACAGAGCTACCTACTACAATCACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCATTACAGAAGGGACCACTACCACAGAGCTACCTACTACAGTCACTACAGAAGGTACCACTACCACTGAACTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCATTACAGAAGGGACCACTACCACAGAGCTACCTACTACAATCACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCATTACAGAAGGGACCACTACCACAGAGCTACCTACTACAATCACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACTGAACTACCGACTACAATAACTACAGAAGGTATAACTACAACAGAGCTACCCACTACAATAACTACAGAAGGTACAACTACAACAGAGCTACCGACTACAATCACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAACTACCCACTACAATAACTACAGAGGGTACAACTACAACAGAAGTACCGAGTACAATAACTACAGAAGGTATAACTACAACAGAGTTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAACTACCGACTACAATAACTACTGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCCACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACTGAACTACCGACTACAATAACTACAGAAGAGGGTACAACTACAACAGAAGTACCGAGTACAATATCTACAGAAGGTATAACTACAACAGAGTTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAACTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAAGTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGCTACCACTACCACAGAAGTACCGACTACAATAACTACAGAAGTTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCCACTACAATAACTACAGAGGGTATAACTACAACAGAAGTACCGAGTACAATAACTACAGAAGGTACCACTACCACTGAACTACCCACTACAATAACTACAGAGGGTACAACTACAACAGAAGTACCGAGTACAATAACTACAGAAGGTATAACTACAACAGAGTTACCTACAACAGTCACTACAGAGGGTACAACTACAACAGAATTACCGACTACAATAACTACAGAGGGTACCACCACAGAACTGCCCACTTCGGTCACCACGGAGGGCATTACTACAACAGAATTACCTACAACAGTCACTACAGAAGGGACCACTACCACAGAGCTACCTACTACAATCACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACTGAACTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAAGTACCGACTACAATAGCTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCTACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGGACCACTACCACAGAGCTACCGACTACAATCACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAACTACCCACTACAATAACTACAGAGGGTACAACTACAACAGAAGTACCGAGTACAATAACTACAGAAGGTATAACTACAACAGAGTTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAACTACCGACTACAATAACTACTGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCCACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACTGAACTACCGACTACAATAACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAAGTACCACTACCACAGAACTACCCACTACAATAACTACAGAGGGTACAACTACAACAGAAGTACCGAGTACAATATCTACAGAAGGTATAACTACAACAGAGTTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAACTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAAGTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAAGTACCGACTACAATAACTACAGAAGTTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCCACTACAATAACTACAGAGGGTATAACTACAACAGAAGTACCGAGTACAATAACTACAGAAGGTACCACTACCACTGAACTACCCACTACAATAACTACAGAGGGTACAACTACAACAGAAGTACCGAGTACAATAACTACAGAAGGTATAACTACAACAGAGTTACCTACAACAGTCACTACAGAGGGTACAACTACAACAGAATTACCGACTACAATAACTACAGAGGGTACCACCACAGAACTGCCCACTTCGGTCACCACGGAGGGCATTACTACAACAGAATTACCTACAACAGTCACTACAGAAGGGACCACTACCACAGAGCTACCTACTACAATCACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACTGAACTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCATTACAGAAGGGACCACTACCACAGAGCTACCTACTACAATAACTACAGAGGGTACAATTACAACAGAGCTACCTACAACAGTCACTACAGAAGGGACCACTACCACAGAGCTACCTACTACAATCACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACTGAACTACCGACTACAATAACTACAGACGGTACAACTACAACAGAGCTACCTACAACAGTCATTACAGAAGGGACCACTACCACAGAGCTACCTACTACAATCACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCATTACAGAAGGGACCACTACCACAGAGCTACCTACTACAGTCACTACAGAAGGTACCACTACCACTGAACTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCATTACAGAAGGGACCACTACCACAGAGCTACCTACTACAATCACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCATTACAGAAGGGACCACTACCACAGAGCTACCTACTACAATCACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACTGAACTACCGACTACAATAACTACAGAAGGTATAACTACAACAGAGCTACCCACTACAATAACTACAGAAGGTACAACTACAACAGAGCTACCGACTACAATCACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAACTACCCACTACAATAACTACAGAGGGTACAACTACAACAGAAGTACCGAGTACAATAACTACAGAAGGTATAACTACAACAGAGTTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAACTACCGACTACAATAACTACTGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCCATTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACTGAACTACCGACTACAATAACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAAGTACCACTACCACAGAACTACCCACTACAATAACTACAGAGGGTACAACTACAACAGAAGTACCGAGTACAATATCTACAGAAGGTATAACTACAACAGAGTTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAACTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAAGTACCGACTACAATAACTACAGAGGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAAGTACCGACTACAATAACTACAGAAGGTACAACTACAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCCACTACAATAACTACAGAGGGTATAACTACAACAGAAGTACCGAGTACAATAACTACAGAAGGTACCACTACCACTGAACTACCCACTACAATAACTACAGAGGGTACAACTACAACAGAAGTACCGAGTACAATAACTACAGAAGGTATAACTACAACAGAGTTACCTACAACAGTCACTACAGAGGGTACAACTACAACAGAATTACCGACTACAATAACTACAGAGGGTACCACCACAGAACTGCCCACTTCGGTCACCACGGAGGGCATTACTACAACAGAATTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAACTACCGACTACAATAACTACAGAGGGTACAACTGCTACAGAGTTACCGACAACAGTCACTACAGAAGGTACCATAACTACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCTACTATAGTAACCACAGAAGGTACCACAACTACAGAACAACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCTACTACAGTAACTACAGAAGGTACCACAACTACAGAAGTACCGACTACAATAACTACAGAGGGTACAACTATAACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAATTACCGACTACAATAACTACAGAGGGTACCACCACAGAACTGCCCACTTCGGTCACCACGGAGGGCATTACTACAACAGAATTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAACTACCGACTACAATAACTACAGAGGGTACAACTGCTACAGAGTTACCGACAACAGTCACTACAGAAGGTACCATAACTACAGAGCTACCTACAACAGTCACTACAGAAGGTACCACTACCACAGAGCTACCTACTATAGTAACCACAGACGGTACAACTACCACCCTTGTTACTGATCTACCAACGACAGCTACCACTGAAGATCTTACCACGGTAGTTACAGAAGATACCACAACAACAACGCTCGTCACATCTACCCCAGAAGTGACGTCCACTACAGAGGCGGAGACGACCACGCCCTCGATTTGTCCTCCTGGGTTCTTCGGGAACATTCCGCATCCGTATCTCTGTAATTCATTTTTCATGTGTCTCGATGGCTTGGCGATACAAATGTTCTGCGCTGTTGGATTTGAATTCGACCCAGCTACTGAGACTTGCGTCATCATCGCCGAGGGAGGCTGCACGTTGGGCACAAGACCTCCGACAGCTTCTACTCCTGAATATACAACTGTAGACTTTTCTACAACTGGAACGCCTTTTACAGTCACAGAAGAATCAACGTATCTTACTACAGATGGGATCAGTACAGTGACTAATGAATTACCAAGTACCTTATCTACTACAGAAGAAGGGACGTCTACAGTAACGACATCAGAGTATACTACTACAGAATTACCTACTACTAGTACCCCTGTTACAGTAACGGACGAATCCACATATTCTACGACTGATTGGCCTACAACAATAACTACAGAAAGTTCAAGTACTACTGAAGTTATCACAGATGTACCTACTTCAATTACAACTGAAGAGTCTTCTACAGCGTCAACTGTAATTACATCTACTACTGACTTGCCTACTACAGTAACCTCAGAAGGTACCTCTTCTATTCCAACTACCATCACTACGGAGGATACACCAACAGCGACCACCGAAAGTACTTTTACTACTGAGTTGCCAACAGAGAGTACAACAACCGGTACTGCAGAGGGTACCAGTACGACGGAATTACCTTCCACACCAACAACTCTCGTCCCCTCAACCCCAGAGATTACTTCTACTACAGAAGCGGAGACGACTACGCCCTCTATTTGTCCTCCTGGATTCTCTGGGAACCTTCCGCATCCGTATCTCTGTAATTCGTACTTTATGTGTATCAATGGCGTCGCGATACAAGTCTTCTGTGCTGAAGGATTTGAGTTTGATCCAATCACTGAGGCTTGCGTGATTATAGCTGAAGGAGGTTGCACATTAGGAACAAGACCTCCAACATATACTACTCCTGGGTATACAACTACAGAATCATCTACCACTACATCACCAACAGCCACAGACGAATCTACTTATATTACCACTGACGGGCTAACCACAGCTACTCAAGGCACTTCTACTACTGAGCTGCCAACTTCAGTAACAGCAGAGAGTACTTCTACTATACTGCCTACTACAATAACTACAGAAGGCACTCCTACTAGTGACTCACCTACGACACTAACTACAGTTGATACGACAGTGTCAACAGATGGCACCACAACCACGGAAGTAACCACTGATATACCCACTTCAGTTACTACTGAAGATTCTACGACGTTAACTACAGAAGGTACAAGTACGACTGAGTTATCTTCCACACCAACAACCTTTGCCCCATCAACTCCAGAAGTGACATCTACTACAGAAGCGGAGACAACTACGCCTTCGATTTGTCCTCCTGGTTTCTTCGGGAACATTCCGCATCCGTATCTCTGTAATTCATACTTCATGTGCGTCAACGGAATAGCTATACAACTCTTCTGCGGCGAAGGATATGAATTTGATCCGGCCAATGAGATTTGCGTCATCATAGCTGAAGGAGGATGCACGTTGGGAACGAGGCCGCCAACACATACTACCCCTGAGTATACTACTACAGATCATTCTACCACAGTGCTGCCTACTACAGTTACAGACGGATCTACGTATTTGACTACTGACAGTTCTACTACAGTAACTACAGATTCTTCTACTGAGGATGCAGGTACTACTGAAGCTACTACTGAACTGCCTACCTCGGTTACTACAGAAAGTTCTACTACACTAGCTACTGAAGGTACTAGTACAACTGAACTTCCCACTGTCACCACCACTGAAGAGTCTACCACAGTAACTACCGAGGGAACTTTCACTCCTGAAATATCTTCCACACCAACAACCCTTGTCCCCTCAACTCCCGAGATCACCTCTACTACAGAAGCGGAGACGACCACGCCCTCTATTTGTCCTCCTGGATTCTTCGGGAACATTCCGCATCCGTATCTCTGTAATTCATACTTCATGTGTGTCAACGGAATAGCTATACAACTCTTCTGCGGCGAAGGATATGAATTTGATCCAGCTAATGAGATTTGCGTCATCATAGCTGAAGGAGGATGCACGTTGGGAACAAGGCCGCCAACACATACCACCCCTGAGTATACTACTACAGACCACTCTACCACTGCGCTGCCTACTACAGTTACAGACGGATCTACGTATTTGACTACTGAGAGTTCTACTACAGTAACTACAGATTCCCCCACTGAGGATGCAAGTACTACTGAAGCTACTACTGAACTGCCTACCTCTGTCACTACGGAAAGTTCTACTACACTAGTTACTGAAGATACTAGTACAACTGAACTTCCCACTGCCAGCACCACTGAAGACTCTACCGCAGCAACTACTGCCGGTTCTACTATAGTAACTACCGAGGGAACCTTCACTACTGAAATATCTTCCACACCAACAACCCTCGTCCCCTCAACTCCAGAGATCACATCTACTACAGAAGCGGAGACGACCACGCCCTCTATTTGTCCTCCTGGATTCTTCGGGAACATTCCGCATCCGTATCTCTGTAATTCATACTTCATGTGTGTCAACGGAATAGCTATACAACTCTTCTGCGGCGAAGGATATGAATTTGATCCAGCTAATGAGATTTGCGTCATCATAGCTGAAGGAGGATGCACGTTGGGAACAAGGCCGCCAACACATACCACCCCTGAGTATACTACTACAGACCACTCTACCACTGCGCTGCCTACTACAGTTACAGACGGATCTACGTATTTGACTACTGAGAGTTCTACTACAGTAACTACAGATTCCCCCACTGAGGATGCAAGTACTACTGAAGCTACTACTGAACTGCCTACCTCTGTCACTACGGAAAGTTCTACTACACTAGTTACTGAAGATACTAGTACAACTGAACTTCCCACTGCCAGCACCACTGAAGACTCTACCGCAGCAACTACTGCCGGTTCTACTATAGTAACTACCGAGGGAACCTTCACTACTGAAATATCTTCCACACCAACAACCCTCGTCCCCTCAACTCCAGAGATCACATCTACTACAGAAGCGGAGACGACCACGCCCTCTATTTGTCCTCCTGGATTCTTCGGGAACCTTCCGCATCCGACTCTCTGTAATTCGTACTTTATGTGTCTTAATGGCGTCGCGATACAAGTCTTCTGCGCCGAAGGATACGAGTTCGATCCTGCTACCGAGACTTGCGTCATCATAGCTGAGGGAGGATGCACGTTGGGAACCAGGCCGCCAACACATACTACTCCAGAGTATACAACTATAGACTCATCTACTACTGCAGCGCCTTCCACAGTCACAGATGAAACCACATATCTTACTACAGGCGGAATTACCACAACATCTCCTGAAAGTCCTACAACTACTGATCTGCCAACTTCAGTAACAACAGAAGAAACAACTACATTAACTACTTCTGAGGACACAACAACGGAATTGCCTACTACTGCGCCTCCTGTAACAGTCACAGATGAATCTACGTATCCTACTACAGACGCCACAGACGCTTCTTCTACTACTGAGTTGCCTACTACAATAACTACTGAAGGAACCATTACCACTGAAGTATCTTCCACGTTAACAACAGTCCCCTCAACTCCAGAGATCACATCTACTACAGTAGCGGAGACGACTACGCCCTCGATTTGTCCTCCTGGATTCTTCGGGAACATTCCGCATCCGTATCTCTGTAATTCATACTTCATGTGCGTCAACGGAATAGCTATACAACTCTTCTGCGGCGAAGGATATGAATTTGATCCGGCCAATGAGATTTGCGTCATCATTGCTGAAGGAGGATGCACGTTAGGAACAAGGCCGCCAACATATACTACTCCAGAGTATACAACTATAGACTCCTCTACTACTGCAGCGCCTTCCACAGTCACAGATGAAACCACATATCTTACTACAGACGGAATTACCACAACATCTCCTGAAAGTCCTACAACTACAGATCTGCTAACTTCAGTAACAACAGAAGAAACAACTACATTAACTACTTCTGAGGATACAACAACGGAATTGCCTACTACTGCGCCTCCTGTAACAGTCACAGATGAGTCTACGTATCCTACTTCAGATGCCACAGACGCTTCTCCTACCACTAAGTTGCCTACTACAGTAACTACTGAGGGAACCATTACCACTGAAGTATCTTCCACGTTAACAACATTCCCCTCAACTCCAGAGATCACATCTACTACAGTAGTAGAGACGACTACGCCCTCTATTTGTCCTCCTGGATTCTTCGGGAACATTCCGCACCCGTATCTCTGTAATTCATACTTCATGTGCGTCAACGGAATAGCTATACAACTCTTCTGCGGCGAAGGATATGAATTTGATCCGGCCAATGAGATTTGCGTCGTCATAGCTGAAGGAGGCTGCACGTTAGGGACAAGACCTCCAACACATACTACCCCTGAGTATACTACTACAGACCACTCTACCACTGCGCTGCCTACTACAGTTACAGATGGATCTACATATCTGACTACTGACAGTTCTACGACAGTAACTACAGATTCTTCTACTGAGGATGCAAGTACTACTGAAGCTACTACTGAACTACCTACCTCGGTCACTACGGAAAGTTCTACTACACTAGCTACTGAAGGTACCAGTACAACCGATCTTCCCACTGCCAGCACCACTGAAGACTCTACCACAGTAACTACTGAGGGAACTTTCACTACTGAAATATCTTCCACACCAACAACCCTCGTCCCCTCAACTCCAGAGATTACATCTACTACAGAAGTGGAGACGACTACACCCTCTATTTGTCCTCCTGGATTCTTCGGGAACCTTCCGCATCCGACTCTCTGTAATTCGTACTTTATGTGCATCAATGGCGTCGCGATACAAGTCTTCTGTGCTGAAGGATACGAGTTCGATCCTGCTACCGAGACTTGCGTCATCATAGCTGAAGGAGGATGCACGTTGGGAACCAGGCCGCCAACACATACTACTCCAGAGTATACAACTATAGACTCATCTACTACTGCAGCGCCTTCCACAGTCACAGATGAAACCACATATCTTACTACAGACGGAATCACCACAACATCTCCTGAAAGTCCTACGACTACTGATCTGCCAACTTCAGTAACAACAGAAGAAACAACTACATTAACTACTTCTGAGGACACAACAACGGAATTGCCTACTACTGCGCCTCCTGTAACAGTCACAGATGAATCTACGTATCCTACTACAGACGCCACAGACGCTTCTTCTACTACTGAGTTGCCTACTACAATAACTACTGAGGGAACCATTACCACTGAAGTATCTTCCACGTTAACAACAGTCCCCTCAACTCCAGAGATCACATCTACTACAGTAGCGGAGACGACTACGCCCTCGATTTGTCCTCCTGGATTCTTCGGGAACATTCCGCATCCGTATCTCTGTAATTCATACTTCATGTGCGTCAACGGAATAGCTATACAACTCTTCTGCGGCGAAGGATATGAATTTGATCCGGCCAATGAGATTTGCGTCATCATAGCTGAGGGAGGATGCACGTTAGGAACAAGGCCGCCAACATATACTACTCCAGAGTATACAACTATAGACTCCTCTACTACTGCAGCGCCTTCCACAGTCACAGATGAAACCACATATCTTACTACAGACGGAATTACCACAACATCTCCTGAAAATCCTACAACTACAGATCTGCTAACTTCAGTAACAACAGAAGGAACAACTAAATTAACTACTTCTGAGGACACAACAACGGAATTGCCTACTACTGCGCCTCCTGTAACAGTCACAGATGAGTCCACGTATCCTACTTCAGATGCCACAGACGCTTCTTCTACCACCGAGTTGCCTACTACAGTAACTACTGAGGGAGCCATTACCACTGAAGTATCTTCCACGTTAACAACATTCCCCTCAACTCCAGAGATCACATCTACTACAGTAGTGGAGACGACTACACCCTCTATTTGTCCTCCTGGATTCTTCGGGAACCTTCCGCATCCGACTCTCTGTAATTCGTACTTCATGTGCGTCAACGGAATAGCTATACAACTCTTCTGCGGCGAAGGATATGAATTTGATCCGGTCAATGAGATTTGCGTCGTCATAGCTGAAGGAGGCTGCACGTTAGGGACAAGACCTCCAACACATACTACCCCTGAGTATACTACTACAGACCACTCTACCACTGCGCTGCCTACTACAGTTACAGATGGATCTACATATCTGACTACTGACAGTTCTACGACAGTAACTACAGATTCTTCTACTGAGGATGCAAGTACTACTGAGGCTACTACTGAACTGCCTACCTCGGTCACTACGGAAAGTTCTACTACACTAGTAACTAAAGGTACTAGTACAACTGAACTACCCACAGTAACTACCGAGGGAACTTTCACTACTGAAATATCTTCCACACCAACAACCCTCGTCCCCTCAACTCCAGAGATCACATCTACTACAGAAGTGGAGACGACTACACCCTCGATTTGTCCTCCTGGATTCGTCGGGAACCTTCCGCATCCGACTCTCTGTAATTCGTACTTTATGTGCATCAATGGCGTCGCGATACAAGTCTTCTGCGCTGAAGGATACGAGTTCGATCCTGCTACCGAGACTTGCGTCATCATAGCTGAGGGAGGATGCACGTTGGGAACCAGGCCGCCAACACATACTACTCCAGAGTATACAACTATAGACTCATCTACTACTGCAGCCACTACCACAGTCACAGATGAATCCACACATCTCACCACGGATGACTCTACAACAGTAACTGCTGAAGCCACTACAGCAGTACCAAGTACGATTTCGACTGACGGGTCTACTATAGTACCTACCGAGGGGATTAGTACTACTGATGAGTCTACCGTAGCAACTACTGAGGGCATTAGTACTACTGAACTAACTACGGCAGTGCCAACTACTGAAGGAACTGTCACCGCTGAAGTGTCTTCCACACCAACAACCCTTGTTCCCTCAACTCCAGAGATCACATCTACTACAGAAGCGGAGACGACTACACCCTCTATTTGTCCTCCTGGATTCTTCGGGAACCTTCCGCATCCGTATCTCTGTAATTCGTACTTTATGTGTCTCAATGGCGTGGCTATACAAGTCTTCTGCGCTGAAGGATTTGAGTTCGACCCTGCTAGTGAGGCTTGCGTGATTATAGCTGAAGGAGGTTGCACATTAGGAACAAGACCTCCAACAGATACTACTCCTGGGTATACAGCTACAGACTCATCTACCACTGCATCACCAACAGCCACAGATGAATCTACTTACATTACTACTGATGGTCTAACTACAGTAACTACTGAAGGAATGAGTACAACTGAAGTCAATACCGACCAACCTACTACTATAACGACAGCAGAATCCACCACAGTAACTACAGGTGACACTACTGAATATTCTACTACACTAGCTACCGAGGGCACAAGTACTACTGAACAGCCCACCTCTGTCACTACTGACGATCCTAATACAGTGACTACTGAAGCTAGTACTGACGCGCGCACTTCAGTCACTAGTGACTCTACAACTACTATAACGACTGAAGGTATAAGTACTACTCAAATACCAACTTCAATAACAACTGAAGATTATTCTGAAGTCACTACGGAAAGTTTGAGTACAACTGACCTACTCACTTCGACTACTGTAGAAGATCCGACTACATTAACTACAGAGGGTACGAGTACCACTGAAGTATCTTCCACAATAACAACCATACTCCCATCAACCCCAGAAGTGACATCTACTACAGAAGCGGAGACGACCACGCCCTCTATTTGTCCTCCTGGATTCTTCGGGAACATTCCGCATCCGTATCTCTGTAATTCATACTTCATGTGCGTCAACGGAATAGCTATACAACTCTTCTGCGGGGAAGGATATGAATTTGATCCGGCCAATGAGGTCTGCGTCGTCATAGCTGAAGGAGGCTGCACGTTAGGGACAAGACCTCCCACACACTCTACACCTGGGTATACAACTACAGACTCGTCTCAAACTGTAGCACCTTCTACAGTCACAGATGAATCCACATATCTCACTACTGATGGTTCTACAACAGTAACTGCTGAAGTCACTACAGCAGTACCAACTACAATCTCGACTGATGAGTCTACCATAGCACCTACCGAAGGGATTAGTACTACTGATGAGTCTACCGTAGCAACTACTGAGGGCATTAGTACTACTGAACTAACTACAGCAGTGCCAACTACTGAAGGAACTGTCACCACCGAAGTGTCTTCCACACCAACAACCCTCGTTCCCTCAACTCCAGAGATCACATCTACTACAGAAGCGGAGACGACTACGCCCTCTATTTGTCCTCCTGGATTCTTCGGGAACATTCCGCACCCGTATCTCTGTAATTCATACTTCATGTGCGTTAACGGAATAGCTATACAACTCTTCTGCGGCGAAGGATATGAGTTTGATCCTCCTACAGAGAACTGCGTCATAATCGCCGAAGGAGGTTGCACACTGGGAACAACACCCCCGATAGACACCACTTCTTCATATATAACTACTACGCTTAGCCCTACCGACGGCTCTACCGTAGTGACTACTGAACGAACAACTAACACTGAAGTACCAACTTCAATGACTACGAATGATGCTACTACAATGACTACCGAAGTCACCTCCGCCACTTCTGAGACAACTACTGACATATCGTCTACCGTCGATAGTGTGGCTACGACCACTGAAGCGGAGACCACAAGGCCACCGATTTGTTCTCCAGGTTTCTTCGGACAAATCCCTCATCCAGAACTCTGTAATTCCTTCTTCATGTGCATGGGAGGGCCACATGCGATACAGCTGTTCTGTTCTGAAGGTTTCGAATTTGATCCAATACAAGAGACATGCGTCATCATAGCCGAAGGAGGATGTACCCTCGGACCAGTTCCAAATCCTACCACCACTCAAAGTCCTAACACTGCCACTACTGAAACGCCTACACAAACTGAAAGTAGCACAACTACTGCGGCTACCACGCAAGGTTATTCCACAACAGAAGACGATAAATCCACCACAGAGTTTACTGCCACAACTGCGGATGATGCAACTTCTGAAGCTACTTCTGAATCGACTACTTCGACTAGTCTAGAAACAGAAGCGACAACTGTTGCAGCCACTGATACTCCCAGTACTGGTACAACCGTGGAAGCGACTACTGAAGTTGTCGAGACAACCACAGCCGGGTCAGGGACGACAGTACCGGCGATCTGTCCGCCCGGTTTCTTTGGATACGTACCGCACCCGGAGATGTGCGACTCGTATTTCCTGTGCACGTTTGGAACCGCCGTGCAGCTGTTCTGTTTGGAGGGCTACGAGTTCGACCCCGCGTCCGAGCAATGCGTAGTCATAGCTGAGGGAGGATGTACTCTTGGTGGCACTTCAAAACCACCAGCGTTACCAACGGACCCAGTACCAACCGAAACGACAACAACTGACATAACTACTACACCAACGCCTTCTTTAACTACTGAAGATGGTGATGCTACTACTTCAGAAGCCCCTACTGCTACTGATATAGTATCCACATCAACTGAACATACCGATTCGACTCCTACCACCGTTACAACAACGGAAATACCAACCCCGAATCCTACAACAGCATCAGATGAAACAGTATCTACTGTTGAAGTGACGACTGTAGAAGCTTCAACTGATAAGCCCATCAGTACAACTTCGATTTCGACTGAAGATGGAACCGCGAGTTCGGAAACCAGCGCTGCAACTTCGGTGACCAGTGGCGATTACGAAACTTCGACTGCAACTGTCGAAACTACCACTCAGTCGATGTGTCCGCCCGGCTTCGTCGGTACTTTACCGCACCCGGATATATGTTACAGTTATTTCCTGTGCGTTTCCGGACAACCGGTTCAGCTCTTCTGTTTGGAGGGATACGAATACGACCCGATTTCGATGGAATGTGTGATCATCGCTGAAGGTGGTTGCACCTTGGGCCCGGCAACCAGCCCGACAGAGGTGACAGACGGTGGTTTCAGCACTGAACAAACATTCACGACAACTGAACGCACAACCAGTCACACTACGACGACTGATGACGCGGCCACACCAGAAGCCAGTACCACAACTGATATTACTTCGCCAACGGTGGAACAGACGGACGCCACCACACATGCACCAACCGAAACTGGTGCTACGGACGCTGCAACCGATGCTTCCACTACAGCACTAACTACCGAGGAAACAGATTCAACCACAGAGGGTTCTACGTCTGAAGCGACTGCAGCCGAAACTTCTGCAACGACTTCTGCTCCGCCCGCCATGTGCCCGCCGGACTTCTTCGGCAACATACCGCACCCGGAGCTGTGCAATTCGTTCTTCATGTGCGCTGCTGGTAACGCCATCCAACTGTTCTGCGGCGAAGGACATGAATTCGATCCGGCACTAGATACTTGCGTGGTGATAGCTGAAGGAGGTTGCACTCTAGGACCAGCCACGTCTCCAACAACTAACCTTCCTACTATCACGCCGACGAGCACAAATCCCCCAGCAGAAACCCAAACTACAGAACCCATACCGACAACAAACTACCCATCTACTTCTGAAACCCAAGAATCAACAGTCATCGCTTCTACCACAGTCGGTTCCAACACCGACTCGACTTCAATAACCGATGGCCAAACAGACTCACAGACCACAGAGTCTGGTTCGAATACAGAGTCGCAACCGACGACTTCTGGAGCTACATCGACAACCGAAGCGTCAACAACCACGGTTGCCATGGAAACCGAACCACCGGCTCTGTGCCCACCGGATTTCTTCGGAACTAAGCCCCATCCGGTTATTTGCTACTCTTTCTACATGTGCACGGCTGGCACCGCTCTCCAGCTCTTCTGCAGCGAAGGCTACGAGTACTCCACCCAAGTAGAGACGTGCGTAAGAATAGCACCTGGTGGTTGCACGTTGGGACCGATAGTTGAGACTACGACAAACGCGGCGACCAGCACTACTTCAGAAACCGACGCTTCGAATTCACCAACAGCTTCGGTTCCCGCAACCGAAGCGGACACAACCACCGCGCAACCTACCACCGATGAAACCACTTCTCGGACTTCAGAGGCTGCTACGTCTACTGAAGCGTCTGCGGCCACAGAAGCGCCGCCAATCTGTCCGCCTGGCTTCGTGGGTACCCTGCCGCATCCGGACCTCTGCAATTCTTTCATCATGTGCGCTGGCGGTGTCCCCTTGCAGTTGTTCTGTAGTGAAGGGTTCGAATATGACCCCGCCGCTGAGGTAAGTTAA
Protein
MLSQIMYKAIIFLTLIAASSAQYLPNGCPSNFHIHLLLPHETDCSKFYSCSNGRKVLQACAGGTLFDFKAQICNWPSAVNCTTRPPAPEVTTHPAPVPTQPPTVPPETVPPTTTPPVTSPAPTSPPGSDFLPNGCPKDIHVHWLVPHEYDCTKFYQCTHGNLVLKTCSGGLYFDFALQVCNWPFMVNCTTSTTLSPTTASPTETTPIVTSPSATTPSPAPVTTPSTTTTRPPTTEGAFLPNGCPADFHVHLLLPHETDCTKFYYCAHGEKVLRQCGPNTAFNFELQVCDWYFNVNCTIPDATTEGPPSSTPTTVPTTTEDVLTTYDPKTTTLQPIFTTDIVETTTADDGGEDGDVTTTTESSITTHLPTVVPTTTTELPTTVTTEGTTTKLPTTVTTEGTTNTELPTTITTEGTTTTELPTTITTEGITTTELPTTITTEGTTTTELPTTITTEGTITTELPTTVTTEGTTTTEVPTTITTEGTTTTELPTTVTTEGTTTTDLPTTITTEGTTTTELPTTITTVGTTTTELPTTITTEGTTTTELPTTITTEGTTTTELPTIVTTEGTTTTEVPTTITTEGTTTTELPTTVTTEGTTTTEVPTTITTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTEVPTTITTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTITELPTTVTTESTTITELPTTVTTEGTTTTEVPTTITTEGTTTTELPTTVFTESTTITELPTTITTEGTTTTELPSTITTEGITTTELPTTVTTEGTTTTELPTTITTEGTTTTELLTTVTTEGTTTTELPTTITTEGTTTTELPTTITTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTITTELPTTITTEGTTTTELPTTITTEGTTTTEVPTTIATEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVITEGTTTTELPTTITTEGTITTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTVTTEGTTTTELPTTITTDGTTTTELPTTVITEGTTTTELPTTITTEGTTTTELPTTVITEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVITEGTTTTELPTTITTEGTTTTELPTTVITEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTVTTEGTTTTELPTTITTEGITTTELPTTITTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTEVPSTITTEGITTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTITTEEGTTTTEVPSTISTEGITTTELPTTVTTEGTTTTELPTTITTEGTTTTEVPTTITTEGTTTTELPTTVTTEATTTTEVPTTITTEVTTTTELPTTVTTEGTTTTELPTTITTEGITTTEVPSTITTEGTTTTELPTTITTEGTTTTEVPSTITTEGITTTELPTTVTTEGTTTTELPTTITTEGTTTELPTSVTTEGITTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTEVPTTIATEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTEVPSTITTEGITTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTESTTTTELPTTITTEGTTTTEVPSTISTEGITTTELPTTVTTEGTTTTELPTTITTEGTTTTEVPTTITTEGTTTTELPTTVTTEGTTTTEVPTTITTEVTTTTELPTTVTTEGTTTTELPTTITTEGITTTEVPSTITTEGTTTTELPTTITTEGTTTTEVPSTITTEGITTTELPTTVTTEGTTTTELPTTITTEGTTTELPTSVTTEGITTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVITEGTTTTELPTTITTEGTITTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTVTTEGTTTTELPTTITTDGTTTTELPTTVITEGTTTTELPTTITTEGTTTTELPTTVITEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVITEGTTTTELPTTITTEGTTTTELPTTVITEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTVTTEGTTTTELPTTITTEGITTTELPTTITTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTEVPSTITTEGITTTELPTTVTTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTEGTTTTELPITITTEGTTTTELPTTVTTEGTTTTELPTTITTEGTTTTELPTTVTTESTTTTELPTTITTEGTTTTEVPSTISTEGITTTELPTTVTTEGTTTTELPTTITTEGTTTTEVPTTITTEGTTTTELPTTVTTEGTTTTEVPTTITTEGTTTTELPTTVTTEGTTTTELPTTITTEGITTTEVPSTITTEGTTTTELPTTITTEGTTTTEVPSTITTEGITTTELPTTVTTEGTTTTELPTTITTEGTTTELPTSVTTEGITTTELPTTVTTEGTTTTELPTTITTEGTTATELPTTVTTEGTITTELPTTVTTEGTTTTELPTIVTTEGTTTTEQPTTVTTEGTTTTELPTTVTTEGTTTTEVPTTITTEGTTITELPTTVTTEGTTTTELPTTITTEGTTTELPTSVTTEGITTTELPTTVTTEGTTTTELPTTITTEGTTATELPTTVTTEGTITTELPTTVTTEGTTTTELPTIVTTDGTTTTLVTDLPTTATTEDLTTVVTEDTTTTTLVTSTPEVTSTTEAETTTPSICPPGFFGNIPHPYLCNSFFMCLDGLAIQMFCAVGFEFDPATETCVIIAEGGCTLGTRPPTASTPEYTTVDFSTTGTPFTVTEESTYLTTDGISTVTNELPSTLSTTEEGTSTVTTSEYTTTELPTTSTPVTVTDESTYSTTDWPTTITTESSSTTEVITDVPTSITTEESSTASTVITSTTDLPTTVTSEGTSSIPTTITTEDTPTATTESTFTTELPTESTTTGTAEGTSTTELPSTPTTLVPSTPEITSTTEAETTTPSICPPGFSGNLPHPYLCNSYFMCINGVAIQVFCAEGFEFDPITEACVIIAEGGCTLGTRPPTYTTPGYTTTESSTTTSPTATDESTYITTDGLTTATQGTSTTELPTSVTAESTSTILPTTITTEGTPTSDSPTTLTTVDTTVSTDGTTTTEVTTDIPTSVTTEDSTTLTTEGTSTTELSSTPTTFAPSTPEVTSTTEAETTTPSICPPGFFGNIPHPYLCNSYFMCVNGIAIQLFCGEGYEFDPANEICVIIAEGGCTLGTRPPTHTTPEYTTTDHSTTVLPTTVTDGSTYLTTDSSTTVTTDSSTEDAGTTEATTELPTSVTTESSTTLATEGTSTTELPTVTTTEESTTVTTEGTFTPEISSTPTTLVPSTPEITSTTEAETTTPSICPPGFFGNIPHPYLCNSYFMCVNGIAIQLFCGEGYEFDPANEICVIIAEGGCTLGTRPPTHTTPEYTTTDHSTTALPTTVTDGSTYLTTESSTTVTTDSPTEDASTTEATTELPTSVTTESSTTLVTEDTSTTELPTASTTEDSTAATTAGSTIVTTEGTFTTEISSTPTTLVPSTPEITSTTEAETTTPSICPPGFFGNIPHPYLCNSYFMCVNGIAIQLFCGEGYEFDPANEICVIIAEGGCTLGTRPPTHTTPEYTTTDHSTTALPTTVTDGSTYLTTESSTTVTTDSPTEDASTTEATTELPTSVTTESSTTLVTEDTSTTELPTASTTEDSTAATTAGSTIVTTEGTFTTEISSTPTTLVPSTPEITSTTEAETTTPSICPPGFFGNLPHPTLCNSYFMCLNGVAIQVFCAEGYEFDPATETCVIIAEGGCTLGTRPPTHTTPEYTTIDSSTTAAPSTVTDETTYLTTGGITTTSPESPTTTDLPTSVTTEETTTLTTSEDTTTELPTTAPPVTVTDESTYPTTDATDASSTTELPTTITTEGTITTEVSSTLTTVPSTPEITSTTVAETTTPSICPPGFFGNIPHPYLCNSYFMCVNGIAIQLFCGEGYEFDPANEICVIIAEGGCTLGTRPPTYTTPEYTTIDSSTTAAPSTVTDETTYLTTDGITTTSPESPTTTDLLTSVTTEETTTLTTSEDTTTELPTTAPPVTVTDESTYPTSDATDASPTTKLPTTVTTEGTITTEVSSTLTTFPSTPEITSTTVVETTTPSICPPGFFGNIPHPYLCNSYFMCVNGIAIQLFCGEGYEFDPANEICVVIAEGGCTLGTRPPTHTTPEYTTTDHSTTALPTTVTDGSTYLTTDSSTTVTTDSSTEDASTTEATTELPTSVTTESSTTLATEGTSTTDLPTASTTEDSTTVTTEGTFTTEISSTPTTLVPSTPEITSTTEVETTTPSICPPGFFGNLPHPTLCNSYFMCINGVAIQVFCAEGYEFDPATETCVIIAEGGCTLGTRPPTHTTPEYTTIDSSTTAAPSTVTDETTYLTTDGITTTSPESPTTTDLPTSVTTEETTTLTTSEDTTTELPTTAPPVTVTDESTYPTTDATDASSTTELPTTITTEGTITTEVSSTLTTVPSTPEITSTTVAETTTPSICPPGFFGNIPHPYLCNSYFMCVNGIAIQLFCGEGYEFDPANEICVIIAEGGCTLGTRPPTYTTPEYTTIDSSTTAAPSTVTDETTYLTTDGITTTSPENPTTTDLLTSVTTEGTTKLTTSEDTTTELPTTAPPVTVTDESTYPTSDATDASSTTELPTTVTTEGAITTEVSSTLTTFPSTPEITSTTVVETTTPSICPPGFFGNLPHPTLCNSYFMCVNGIAIQLFCGEGYEFDPVNEICVVIAEGGCTLGTRPPTHTTPEYTTTDHSTTALPTTVTDGSTYLTTDSSTTVTTDSSTEDASTTEATTELPTSVTTESSTTLVTKGTSTTELPTVTTEGTFTTEISSTPTTLVPSTPEITSTTEVETTTPSICPPGFVGNLPHPTLCNSYFMCINGVAIQVFCAEGYEFDPATETCVIIAEGGCTLGTRPPTHTTPEYTTIDSSTTAATTTVTDESTHLTTDDSTTVTAEATTAVPSTISTDGSTIVPTEGISTTDESTVATTEGISTTELTTAVPTTEGTVTAEVSSTPTTLVPSTPEITSTTEAETTTPSICPPGFFGNLPHPYLCNSYFMCLNGVAIQVFCAEGFEFDPASEACVIIAEGGCTLGTRPPTDTTPGYTATDSSTTASPTATDESTYITTDGLTTVTTEGMSTTEVNTDQPTTITTAESTTVTTGDTTEYSTTLATEGTSTTEQPTSVTTDDPNTVTTEASTDARTSVTSDSTTTITTEGISTTQIPTSITTEDYSEVTTESLSTTDLLTSTTVEDPTTLTTEGTSTTEVSSTITTILPSTPEVTSTTEAETTTPSICPPGFFGNIPHPYLCNSYFMCVNGIAIQLFCGEGYEFDPANEVCVVIAEGGCTLGTRPPTHSTPGYTTTDSSQTVAPSTVTDESTYLTTDGSTTVTAEVTTAVPTTISTDESTIAPTEGISTTDESTVATTEGISTTELTTAVPTTEGTVTTEVSSTPTTLVPSTPEITSTTEAETTTPSICPPGFFGNIPHPYLCNSYFMCVNGIAIQLFCGEGYEFDPPTENCVIIAEGGCTLGTTPPIDTTSSYITTTLSPTDGSTVVTTERTTNTEVPTSMTTNDATTMTTEVTSATSETTTDISSTVDSVATTTEAETTRPPICSPGFFGQIPHPELCNSFFMCMGGPHAIQLFCSEGFEFDPIQETCVIIAEGGCTLGPVPNPTTTQSPNTATTETPTQTESSTTTAATTQGYSTTEDDKSTTEFTATTADDATSEATSESTTSTSLETEATTVAATDTPSTGTTVEATTEVVETTTAGSGTTVPAICPPGFFGYVPHPEMCDSYFLCTFGTAVQLFCLEGYEFDPASEQCVVIAEGGCTLGGTSKPPALPTDPVPTETTTTDITTTPTPSLTTEDGDATTSEAPTATDIVSTSTEHTDSTPTTVTTTEIPTPNPTTASDETVSTVEVTTVEASTDKPISTTSISTEDGTASSETSAATSVTSGDYETSTATVETTTQSMCPPGFVGTLPHPDICYSYFLCVSGQPVQLFCLEGYEYDPISMECVIIAEGGCTLGPATSPTEVTDGGFSTEQTFTTTERTTSHTTTTDDAATPEASTTTDITSPTVEQTDATTHAPTETGATDAATDASTTALTTEETDSTTEGSTSEATAAETSATTSAPPAMCPPDFFGNIPHPELCNSFFMCAAGNAIQLFCGEGHEFDPALDTCVVIAEGGCTLGPATSPTTNLPTITPTSTNPPAETQTTEPIPTTNYPSTSETQESTVIASTTVGSNTDSTSITDGQTDSQTTESGSNTESQPTTSGATSTTEASTTTVAMETEPPALCPPDFFGTKPHPVICYSFYMCTAGTALQLFCSEGYEYSTQVETCVRIAPGGCTLGPIVETTTNAATSTTSETDASNSPTASVPATEADTTTAQPTTDETTSRTSEAATSTEASAATEAPPICPPGFVGTLPHPDLCNSFIMCAGGVPLQLFCSEGFEYDPAAEVS

Summary

Uniprot
ProteinModelPortal
PDB
6G9E     E-value=0.00467787,     Score=106

Ontologies

Topology

SignalP
Position:   1 - 21,         Likelihood:  0.994367
 
 
Length:
6927
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.6248
Exp number, first 60 AAs:
3.59196
Total prob of N-in:
0.18211
outside
1  -  6927
 
 

Population Genetic Test Statistics

Pi
228.208534
Theta
184.942307
Tajima's D
0.773609
CLR
0.686421
CSRT
0.590920453977301
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号