SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00902
Pre Gene Modal
BGIBMGA009653
Annotation
PREDICTED:_transcription_factor_CP2-like_protein_1_isoform_X1_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.091
 

Sequence

CDS
ATGGAATATACGGAATATAGAGACTTTACAATGCATGACGTACGTAAAGAGGAGTACGGCTGGGAATCTACAGTTAGACTCATGGTCGGGAGGGAGGACGAATTGGGCATGTACCTGGAGGAGAGCAGGGAGGGCAGGAAGCGGAAGTGGCAGCCCGAGAAAATGAGGCGAGACGGCAGCGAAGATAAAGATCAGAAGAAGGTGCCTCCGAAGAAGATCATGGCTGCCCTAAGCGAGATAGGCGGGAGCGGCACAAGCTCCTCATCCTCGCATTTGTCTCCGGCATGGCAAGTCAACGAACTCGATCTGGACTTGCCCGTCGAACTATCAATGAACGAAGCGCTGTTGTCGCTTCCATCGTTGGCGGTGTTCAAACAGGAGGCTCCGTCCCCGACGGGCGCGGTGCTCTCGCCCCCCCGCCGCCACTGGCCCGTCCCCCGACGGAACGACGATCGGCAGATGACAAGCATGGTTGTCGACGGAGCCCGTGACGGCATGGACGAGTGCCAGCAGTCGCCTTCCCACAACGGAAACGCTATGCAGCATGGAAGTCCCGACGCCTTGCAGTGCCAACAGCAGATGCCGCCGAGCGCCGTCATGCCAATGAACGGTTACCATTCACCAAACGAACACGAGAATAAAAACGCTGGTCTGCTGATCTGCTCCCCGGTGGGCTCGCTGGAGGGCTACCTGCACTCTCCACCACACCTGCAGCCGCGCTCCGACTCCAGCTTCAAGGATGACACCAGGTTCCAGTACGTTCTGGCCGCAGCGACTTCGATAGCAACCAAACAGAACGAGGAAACCCTGACCTACCTCAACCAAGGCCAGTCCTACGAGATCAAGCTCAAGAAGCTCGGAGACTTGTCACATTACAAAGGAAAGCTGCTGAAAAGTGTCATCAAGATATGCTTCCACGAACGCCGCTTGCAGTACATGGAAAGGGAGCAGATAGCGCAGTGGCACGCCGAGAGACCGGGGGAGAGGATCGTAGAAGTGGACGTGCCTCTGTCGTACGGAATTATAAAAGTGGAACAATCCACAGCACTGAACGCGCTCCACGTCTACTGGGACGCCACCAAGGAAGTGGGTGTTTATATAAAGGTGAACTGCATCTCAACGGAATTCACAGCCAAGAAGCACGGCGGCGAGAAGGGAGTCCCATTCCGTATACAGGTCGAGACTTATCTCGCGAGCGACGAGAACAATCGTCTGAACGCCGCCGCCTGCCAGATCAAGGTATTCAAATTGAAAGGCGCCGATCGCAAACACAAACAGGACAGGGAGAAGGTGCTGCGCAGACCGAGGGCCGATCTGGACAAGTACCAGCCCGCCTGCGAGGCCACTGTGCTGACCACGTTGTCACACGACGCGCTGATGCCGCCGCCCTCGCTGGTCACCACCTCGCCGTCCTACTCGCCAGAGCTGTGTGTGACACCTAAATCTGCCTCGAGCCCTATCACTACCAAGCCGATTTCTCAACCAGCCATCGTTGGTACTACTAATCAAATGAAGCCGCTGTATTGTCAAGATGCTGGTGAGATGAAGGTGAGCAGCCCAACCTGCCACTCCCCAGGAGCTATCCTGCCTGATCTACCACAGCCTGCTGAGGAACCAGACAAGAACTTTGGATTATCAAAAGATGCCACCTCCGCCGAGACTCAGGTGTGGTTGTCCCGACAACGGTTCATGCAACACGCCGCCACGTTCGCGAACTTTTCCGGGGCTGATCTGCTGAGACTATCCCGTGATGACATTATCCAGATCGTCGGACTGGCTGATGGCATACGTCTGTTCAACGCACTTCACGCCAAACGCATCTCGCCGCGCCTCACCCTGTACGTGTGCCCGCCCTCCTCCGACGTGCACTGCGCGCTCTACCTGCACGCGTGTCGCGCGCACGAGCTGGTGCACAAGCTGAACGCGCTGCAGGGAGCCGGCAGCAAGGATTGCGAAACCGTATTGGTGTCCGGTCCGAACGGCGCTCGCGTCCGCCTCACCGACGAGCTGGTGCGACATCTGCCAGACAACTCGACTTATCGCCTCAAGAGACTCGAAGACTGCAATGCTCTGCTCCTAAGCGCCACCACCGGCAACTGA
Protein
MEYTEYRDFTMHDVRKEEYGWESTVRLMVGREDELGMYLEESREGRKRKWQPEKMRRDGSEDKDQKKVPPKKIMAALSEIGGSGTSSSSSHLSPAWQVNELDLDLPVELSMNEALLSLPSLAVFKQEAPSPTGAVLSPPRRHWPVPRRNDDRQMTSMVVDGARDGMDECQQSPSHNGNAMQHGSPDALQCQQQMPPSAVMPMNGYHSPNEHENKNAGLLICSPVGSLEGYLHSPPHLQPRSDSSFKDDTRFQYVLAAATSIATKQNEETLTYLNQGQSYEIKLKKLGDLSHYKGKLLKSVIKICFHERRLQYMEREQIAQWHAERPGERIVEVDVPLSYGIIKVEQSTALNALHVYWDATKEVGVYIKVNCISTEFTAKKHGGEKGVPFRIQVETYLASDENNRLNAAACQIKVFKLKGADRKHKQDREKVLRRPRADLDKYQPACEATVLTTLSHDALMPPPSLVTTSPSYSPELCVTPKSASSPITTKPISQPAIVGTTNQMKPLYCQDAGEMKVSSPTCHSPGAILPDLPQPAEEPDKNFGLSKDATSAETQVWLSRQRFMQHAATFANFSGADLLRLSRDDIIQIVGLADGIRLFNALHAKRISPRLTLYVCPPSSDVHCALYLHACRAHELVHKLNALQGAGSKDCETVLVSGPNGARVRLTDELVRHLPDNSTYRLKRLEDCNALLLSATTGN

Summary

EMBL
NEVH01019077    PNF22878.1    PNF22880.1    KQ971354    KYB26457.1    PNF22879.1    + More
GEZM01062471    GEZM01062470    JAV69706.1    GEZM01062469    JAV69708.1    GALX01003456    JAB65010.1    GFDF01007959    JAV06125.1    GFDF01007960    JAV06124.1    GFDF01007958    JAV06126.1    GFDF01007961    JAV06123.1    GEDC01014135    GEDC01012621    GEDC01010142    JAS23163.1    JAS24677.1    JAS27156.1    GECZ01013467    GECZ01008897    GECZ01006525    GECZ01005691    JAS56302.1    JAS60872.1    JAS63244.1    JAS64078.1    GAPW01000612    JAC12986.1    LBMM01000662    KMQ97851.1    CH477227    EAT47108.1    AJWK01013295    AJWK01013296    AJWK01013297    AJWK01013298    AJWK01013299    AJWK01013300    AJWK01013301    AJWK01013302    AJWK01013303    AJWK01013304    NNAY01000542    OXU27781.1    ADTU01008785    ADTU01008786    ADTU01008787    ADTU01008788    ADTU01008789    GDIP01191218    JAJ32184.1    GECL01002910    JAP03214.1    GFTR01007341    JAW09085.1    GACK01001110    JAA63924.1    CVRI01000042    CRK95673.1    GBHO01035091    GBHO01005953    GBHO01005947    GBRD01007938    GBRD01007937    JAG08513.1    JAG37651.1    JAG37657.1    JAG57883.1    GBHO01005951    GBHO01005949    GBHO01005948    GBRD01007941    GBRD01007940    JAG37653.1    JAG37655.1    JAG37656.1    JAG57880.1    GFWV01018613    MAA43341.1    CH916367    EDW02030.1    CM000362    EDX06455.1   
Pfam
PF04516   CP2        + More
PF18016   SAM_3
PF00642   zf-CCCH
PF00383   dCMP_cyt_deam_1
Interpro
IPR041418   SAM_3        + More
IPR013761   SAM/pointed_sf       
IPR040167   TF_CP2-like       
IPR007604   CP2       
IPR016193   Cytidine_deaminase-like       
IPR001841   Znf_RING       
IPR036855   Znf_CCCH_sf       
IPR002125   CMP_dCMP_dom       
IPR000571   Znf_CCCH       
IPR013083   Znf_RING/FYVE/PHD       
SUPFAM
SSF47769   SSF47769        + More
SSF53927   SSF53927       
SSF90229   SSF90229       
Gene 3D
PDB
5MR7     E-value=2.32279e-25,     Score=289

Ontologies

Topology

Length:
699
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00471
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00051
outside
1  -  699
 
 

Population Genetic Test Statistics

Pi
241.362727
Theta
160.468581
Tajima's D
1.718896
CLR
0.01763
CSRT
0.827108644567772
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号