SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00560
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 2.02
 

Sequence

CDS
ATGGCTAGCCAGGAACTGCGCATCATTTATTGGAACCCCGGCGGGGTAAAACCCCGCAAGAACGAGCTCTTGGTTCTCGCCCGGGAGTACAACCCTGAGGTTGTGCTCCTGGGCGAGACCAAGCTACGTCCTCGGGATGTGTTCAGGATTCCAAACTACTTCATGTACCGACGTGACGAGGTGAGTCCTGCCGGGACGCCGTTCAGGGGCACTGCGGCGCTCGTCAGGCGAGACGTGGTGCATGATCAGTTGGATTTGCTGGCCTTCACATCGACAAGGTCGATCGGTGTGAGGATCCACACCTCGGGGGGAGATATGCGGGTTTATGCCGCGTATAGACCCCCGGGGCCTGATTTCCACCCCGGGGACATAAGACGGGTCCTGAATTGCGACAGCCGCCCAGCTCTGCTGGTCGGGGACCTCAACGCGAAGCACGTCGCGTGGGGCTCCCGACTGAACTCAGCAGTGGGCAGGCGGCTGTTAGAAGATGCCGATAGGGGCGACTACTCTGTGGTCGGCCCCGACGAACCCACGCACATTCCGACCGCCGCGCAACTCCAGCCCGACGTGTTGGATGTGTGCGTTCATAAAGGGCTACGGTGCCCCTTAACTATTGAGGCACTGTACGACCTGGGTACCCCCCATCTCCCTATCCTGGTCACACTGGGAATGGGGCTTACCCGGGTTGCGACCTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACTCCTAGTCGACCTTCCCGTAATTCAGGACCCCAACACCCCTGAGGGGGTCGACGACGCGGCAGTCCGCCTTGTCGACTCCATCAGGGGAGCGATCGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTATACTCCCGGCCCATCTGAAAGCGATTATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGCTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTATCGGGGCTATGCGTGGGAGGAACGGATCGAGGAGGCCCGTGAGGACCCCTCGTCCGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGTAATGCTGGAGCGGCAGTTCGCTCCAAATAACTCTGCACCCTCAGAGGCCGCATTCCACCAATCGGTGGAAGAGAGCGTAGCAAGCCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGGTGATTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGCGAGGACGGTATTCCCTCCCTCGCATTTTTCCACTTCCCCGAAACGGTGGTGTCATTCACGACACGACTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAACTTGGAAATTGGGCAAGGTTATTGCCCTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTATCGTCCGATCACTCTGCTGTCGCATATGGGCAAGTTGTTCGAGCGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCTCAGACCCGAGCAATTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTTATGCACCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAGGCCTTCGACCGTGTCTGGCATGCGGGACTGATCTACAAGCTGTTGCAGAACACGGACCTCCAGCACGCCTATGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCCTTGTCGCGGTCGAGGGCGCAAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCACCAGTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTTGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTAAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCCTCTAATTTCCCCTCTGCGGCCATTTCGAGGATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAATGTGGGGAAGACCGCGGCTATCCTCTTCGGTCCGGTCCGCACAAGAGCCGTCCCAGGACAGCTCAGTCTCCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTGGGAGTCAGTATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTATGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGATCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATTCGGAGGCTAGCTCGTAATATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCAGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTCAACTACTGA
Protein
MASQELRIIYWNPGGVKPRKNELLVLAREYNPEVVLLGETKLRPRDVFRIPNYFMYRRDEVSPAGTPFRGTAALVRRDVVHDQLDLLAFTSTRSIGVRIHTSGGDMRVYAAYRPPGPDFHPGDIRRVLNCDSRPALLVGDLNAKHVAWGSRLNSAVGRRLLEDADRGDYSVVGPDEPTHIPTAAQLQPDVLDVCVHKGLRCPLTIEALYDLGTPHLPILVTLGMGLTRVATSPLRPKVDWELFKRLLVDLPVIQDPNTPEGVDDAAVRLVDSIRGAIDQATTLVPSGGPRGILPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSYRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAVMLERQFAPNNSAPSEAAFHQSVEESVASLLSSPVPPLGDGDFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSFTTRLFNSILSTGHFPGTWKLGKVIALPKPGKDRRNPSSYRPITLLSHMGKLFERLLLRRVSPHILLRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIYKLLQNTDLQHAYVRLLGSYLEGRSFLVAVEGAKSSVRPVTAGVPQGSVLAPVLYALYTNDIPTLEGNLQAWEADVKLALFADDSAYFSSSNFPSAAISRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTRAVPGQLSLRGVNVEFRPSVRYLGVSIDRSLRMTAHAKSALAAARYARFLLRPVLASRLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQIMRVKLQAQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGQALPRELLEPPAMVNY

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
NWSH01000895    PCG73652.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02023911    + More
ABLF02034467    GEZM01008457    JAV94772.1    NEVH01017470    PNF24199.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    NEVH01011985    PNF31054.1    NEVH01021205    PNF19912.1    ABLF02042518    ABLF02057746    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GALX01005299    JAB63167.1    GFTR01008279    JAW08147.1    GGMR01004661    MBY17280.1    ABLF02041767    GBBI01004395    JAC14317.1    GFTR01008262    JAW08164.1    ABLF02028535    ABLF02028545    NEVH01007402    PNF35856.1    GALX01005359    JAB63107.1    NEVH01006736    PNF36716.1    NEVH01005277    PNF39135.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01026386    PNF14434.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NEVH01008277    PNF34262.1    NEVH01016340    PNF25410.1    NEVH01015305    PNF27092.1    GGMR01003407    MBY16026.1    NEVH01021925    PNF19341.1    NEVH01023979    PNF17579.1    NEVH01016302    PNF25823.1    NEVH01001347    PNF42959.1    ABLF02017815    GGFL01004957    MBW69135.1    GBGD01000415    JAC88474.1    GGMS01002992    MBY72195.1    GFXV01000908    MBW12713.1    GBBI01004571    JAC14141.1    NEVH01020940    PNF20481.1    KQ973342    KXZ75569.1    GFTR01008246    JAW08180.1    KK119261    KFM75202.1    GGMS01017365    MBY86568.1    AB055391    BAB21761.1    GBBI01003747    JAC14965.1    GBGD01000389    JAC88500.1    AB018558    BAA76304.1    ABLF02025082    ABLF02039175    ABLF02041809    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GFTR01008254    JAW08172.1    NWSH01000032    PCG80496.1    ABLF02008463    NWSH01007753    PCG62823.1    ABLF02055645    M22874    M38643    GEZM01084969    JAV60363.1    KU543687    AMS38379.1    GBBI01003810    JAC14902.1    GEZM01074951    JAV64378.1    ABLF02021177    ABLF02027367    ABLF02066338    GFTR01008269    JAW08157.1    GGMR01016296    MBY28915.1    GFTR01008038    JAW08388.1    GEZM01053022    JAV74219.1    KQ971729    KYB24751.1    AF081103    AAC72921.1    GGMR01012283    MBY24902.1    GGMR01000676    MBY13295.1    KQ459265    KPJ02064.1    LBMM01018163    KMQ83860.1    GGMR01003864    MBY16483.1    GGMS01006359    MBY75562.1    U07847    AAA17752.1    GFTR01008260    JAW08166.1    GGMR01012443    MBY25062.1    GGFJ01001822    MBW50963.1    NEVH01014858    PNF27387.1    ABLF02017813    GFDL01000006    JAV35039.1    NEVH01019964    PNF22161.1    NEVH01007838    PNF34986.1    GGMR01000226    MBY12845.1    GFTR01008271    JAW08155.1    NEVH01002716    PNF41415.1    NEVH01006754    PNF36554.1    KK119692    KFM76444.1    NEVH01002556    PNF42024.1    M17214    AAA28508.1    ABLF02041861    GGMR01012676    MBY25295.1    GFXV01002840    MBW14645.1    NEVH01005295    PNF38784.1    GGMR01020516    MBY33135.1    NEVH01022639    PNF18527.1    GGFJ01001844    MBW50985.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.000178549,     Score=110

Ontologies

Topology

Length:
909
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03407
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00039
outside
1  -  909
 
 

Population Genetic Test Statistics

Pi
26.46009
Theta
26.693817
Tajima's D
-0.379499
CLR
0
CSRT
0.275136243187841
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号