SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16870
Annotation
non-LTR_retrotransposon_R1Bmks_ORF1_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.745 Nuclear   Reliability : 1.456 Nuclear   Reliability : 1.456
 

Sequence

CDS
ATGAATGGATTAACGAGATTCCCACTGTCCCTACACGTCGTGCGCAGCGTGCTGCTTAGGACGCAGCGCCCGTCGTTGACGCTGCTAACGAAGGCCTACCGTTCGTGCAGCACGGCTGCTTTGCCGGTGTTGGCGGGCGTCCTGCCGGCGGACCTGGAGGTGACTCGTGCTGGACGGAGGATGCGGGAGTGCGAAGGATTGGCGCGGGAGTTGGCGGCGGAGAGACGACGACGGATCGACGGCGATGTCTTGGTAGTTTGGCAGAACAGGTGGGTGTCTGAGGGTAAGGGGAGGGAACTGTACAAGTTCTTTCCCGATGTTGCGGACAGGAAGAAGGCAACGTGGATGGAGCCGGACTATCAGACCTCGCAGATCCTCACGGGTCATGGGATCTTTAATAAGCGGTTGGCGGATATGCGACTGAGGGAGGGGCATGCTTGCGACTGCGGGGCGGTTGAGGAGGATAGGGACCATGTCCTGTGGGAGTGTCCTCTCTATGACGAAATCCGGGCAGGATGCTCGATGGAATCTCGCGGTCTGAGGTGGGCCCAGTTTACCACGCGGACCTGGTCAGGGACGAGAAAAATTTTCGGCTCTTGCGCGAGTTCGCGCATACATGGCACACGGCGCGCACTGCGCGCGAATCACGAGGACTGCCTGGCGACGAAGAATGTGGGTGATGTTAGCAGCCCCAGAACGGGGAGAATGCTACTTCCCCATTCCTGTTGCGTCGGGGCTCCGACTGGACCCCTTGATGTAGCAGCGCAGGGGAGGCTGGAGCTGCTCGAGCGGGCAAACCGAGCGGTGCGCGGGATCATGTCGGTGGCGACGGCGGCATCTAAGCTCAATAAGTCGGAGGTCAATCTAATCTCTGAACTCGGTCGCGATATCCTGGCCGTAGTTGGGGCCCTCGGGATCCAGCTCTCTGATAAGGAGCTGGTGGTCGAAAGGCTCCGCTCGGCAGAGGCCTCTGCACGGCGTGACTCCGTGGCGCCTTCGATGGCTGCTGGTGCGGCGGCCGGGTCTGGGACTGGGCCTGCGACCTTCGCCACTGTCCTCAGGACGGGCCCTGGTGGGGTCCCGAGGTCCATTGGGGCCTCTCAGGGGCCTTCCTTGGCATTCTACCCGTCCGAGGGCAATGCGGAACTGAAGACAGCTGAGGACACAAAGAAAGAGGTAAAAAAGGCCATTGACCCTAAGTCAATGGCTATTGGAATACAGAGCGTAAGGAAGGTTGGGAATGCGGGGGTAGTGGTGCAGACCACGTCCCCCGCGGCCGCAGTCAAGCTTAGAAATGCTGCCCCGCCATCACTGAGAGTCACCGAACCCAGGCGCCGACAGCCCTTAGTAGCTGTCAATGGCGTGGAGGGCGACCCCTCCTTCGAGGAGGTAATCGAGTGCCTGGCTAGCCAGAACCTCGACCCGGAGGAGTGGCCCCTCACTAGGGTACGAGCGGAGCTCACGGGGGCGTTCAAAAAGGGGAGGCGACAATCCAACAACACTACTGTGGTGTTTAACGCCTCCCCTCGCATCAGGGACGCCCTCGTGAAGATTGGCAGAGTGTATGTGGGGTGGGTCGCCTGTGAGGTCACGGACTTTGTCCGGGTGACCTGCTGCAATAAGTGTCAGCAATATGGTCACCCGGAGAAATTTTGCCGGGCCAAGGAGGCCACCTGTGGCCGATGTGGAGAGGATGGCCACCGAATGGAGGCCTGTAAGGCAGCCTCCGCGTGCTGTGCGACCTGCCGGCGATTCCGTCGCGAGGCTATGCACCCGACGGCCTCGCGCGACTGTCCGGCGCGCCGGCATGCGGAGGAGCGCTTCCTAAATCAGGTCGAGCACTACGTCGGTCGGGGTCAGGAAGTGGCTGACCGCCGCGCCAAGATGGAGGATTTCATTGGGGCGAGGCGGTTGGTCGTCCATAACGCGGATGGCCACCTGCCGACCTTCAGTACGGCGAACGGAGAATCTTATGTCGATGTCACGCTGTCTACGCGGGGAGTACGCGTGTCTGAATGGCGTGTAACTAATGAATCATCGAGCGATCACCGGCTCATTGTGTTTGGGGTGGGGGGCGGTACAACAGGGGAGCGGGACGAGGACGAGGAGGCGCGGAGCGATTTGAGGCCGGGCGAGCCGTGCGCACTGCGTCGGTACCGGGACCGTGGGGTGGATTGGGACCTCTTCAGATCGCGTATCCACGAGCGAATGGGGAGTCTGGACCTCGAGGAACCTGTGGCTGCCCTTTGCGAAAAATTTACCGGGGTTATAACTCGCACAGCTGAAGAATGCTTAGGATCACTGAAAGCAGATAGAACTGACAGGGGTTATGAGTGGTGGACCCCAGTACTCGATAAGCTTAGGGTAGCCCAGGGTAGGGCCAGGCGTCGATGGCAAAAGGCCCGCCGAACGGGGGGTGAGGAAGAGGAGCAGTCTGGGAGAGTCTTCCGCGACCGCAGGCGCGAGTATCGAAGAGCGATGCATGACGCTGAGACCGCCTTTTACCGGGAGATCGCTGAAGGGGGAAACCGTGACCCGTGGGGACTAGCGTATCGGACGGCGAGTGGTAGGCGACGCGCACCAACTAATGTGGTTAACGGGGTGGAGTATGCGGGCGGTGCTCGGATGATGAAGAAGGCAACGTGGATGGAGCCGGACTATCAGACCTCGCAGATCCTCACGGGTCATGGGATCTTTAATAAGCGGTTGGCGGATATGCGACTGAGGGAGGGGCATGCTTGCGACTGCGGGGCGGTTGAGGAGGATAGGGACCATGTCCTGTGGGAGTGTCCTCTCTATGACGAAATCCGGGGCAGGATGCTCGATGGAATCTCGCGGTCTGAGGTGGGCCCAGTTTACCACGCGGACCTGGTCAGGGACGAGAAAAATTTTCGGCTCTTGCGCGAGTTCGCGCATACATGGCACACGGCGCGCACTGCGCGCGAATCACGAGGACTGCCTGGCGACGAAGAATGTGGGTGA
Protein
MNGLTRFPLSLHVVRSVLLRTQRPSLTLLTKAYRSCSTAALPVLAGVLPADLEVTRAGRRMRECEGLARELAAERRRRIDGDVLVVWQNRWVSEGKGRELYKFFPDVADRKKATWMEPDYQTSQILTGHGIFNKRLADMRLREGHACDCGAVEEDRDHVLWECPLYDEIRAGCSMESRGLRWAQFTTRTWSGTRKIFGSCASSRIHGTRRALRANHEDCLATKNVGDVSSPRTGRMLLPHSCCVGAPTGPLDVAAQGRLELLERANRAVRGIMSVATAASKLNKSEVNLISELGRDILAVVGALGIQLSDKELVVERLRSAEASARRDSVAPSMAAGAAAGSGTGPATFATVLRTGPGGVPRSIGASQGPSLAFYPSEGNAELKTAEDTKKEVKKAIDPKSMAIGIQSVRKVGNAGVVVQTTSPAAAVKLRNAAPPSLRVTEPRRRQPLVAVNGVEGDPSFEEVIECLASQNLDPEEWPLTRVRAELTGAFKKGRRQSNNTTVVFNASPRIRDALVKIGRVYVGWVACEVTDFVRVTCCNKCQQYGHPEKFCRAKEATCGRCGEDGHRMEACKAASACCATCRRFRREAMHPTASRDCPARRHAEERFLNQVEHYVGRGQEVADRRAKMEDFIGARRLVVHNADGHLPTFSTANGESYVDVTLSTRGVRVSEWRVTNESSSDHRLIVFGVGGGTTGERDEDEEARSDLRPGEPCALRRYRDRGVDWDLFRSRIHERMGSLDLEEPVAALCEKFTGVITRTAEECLGSLKADRTDRGYEWWTPVLDKLRVAQGRARRRWQKARRTGGEEEEQSGRVFRDRRREYRRAMHDAETAFYREIAEGGNRDPWGLAYRTASGRRRAPTNVVNGVEYAGGARMMKKATWMEPDYQTSQILTGHGIFNKRLADMRLREGHACDCGAVEEDRDHVLWECPLYDEIRGRMLDGISRSEVGPVYHADLVRDEKNFRLLREFAHTWHTARTARESRGLPGDEECG

Summary

Uniprot
ProteinModelPortal
PDB
2EI9     E-value=3.04044e-40,     Score=419

Ontologies

Topology

Length:
993
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02025
Exp number, first 60 AAs:
0.0186
Total prob of N-in:
0.00097
outside
1  -  993
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.21802
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号