SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16868
Annotation
T18197_reverse_transcriptase-like_protein_-_silkworm
Location in the cell
Nuclear   Reliability : 2.284
 

Sequence

CDS
ATGATGGTGAAGCGGCGGTGGCATGGCGAGGAATCGACCTCCTCGCTCGCACCGAGGCCAGGTTGCTCGCTGAGCGGGGTCAGTGCTCGGGTGGAGACCTCTTTGGCGCGCTTCCAGGGTTTGGAAGAACTCTGGAAGCGATTAAGGGACAACGGCGGAGGGAGCCTTATCGGGCATTGGTGCAAGCGCACCTTGCCCGATTTGGTTCCCAGCCGGGTCCCTCGTCAGGGGGGGTGCTCGGCCGAGCCTGACTTCCGGCGGGCTTCTGGAGCTGAGGAAGCGGGCGAGGAACGATGCGCCGAAGACGCCGCTGCCTATGATCCATCCGCAGTCGGTCAGATGTCGCCCGATGCCGCTCGGGTTCTCTCCGAACTCCTTGAGGGTTCGGGGAGAAGACGAGCGTGCAGGGCTATGAGACCCAAGACTGCAGGGCGGCGAAACGATTTGCACGATGATCGGACAGCTAGTGCCCACAAAACCAGTAGACAAAAGCGCAGAGCAGAGTACGCGCGTGTGCAGGAACTGTACAAGAAGTGTCGCAGCAGAGCAGCAGCTGAGTGGCGTGCGGTTCCTGTGCACTTGAAGGCGGAAATGTTCAATGCATGGATGGCACGAGGCGAAATACCCGAAATTCTACGGCAGTGCCGAACCGTCTTTGTGCCTAAGGTGGAGAGACCAGGTGGACCGGGGGAATATCGACCGATCTCGATCGCGTCGATTCCCCTGAGACACTTTCACTCCATCTTGGCCCGGAGGCTGTTGGCTTGCTGCCCCCCTGATGCACGACAGCGCGGATTTATCTGCGCCGACGGTACGCTGGAGAATTCCGCAGTACTGGACGCGGTGCTTGGGGATAGCAGGAAGAAGCTGCGGGAATGTCACGTGGCGGTGCTAGACTTCGCCAAGGCATTTGACACAGTGTCTCACGAGGCACTTGTCGAATTGCTGAGGTTGAGGGGCATGCCCGAACAGTTCTGCGGCTACATTGCTCACCTATACGATACGGCGTCCACCACCTTAGCCGTGAACAATGAAATGAGCAGCCCTGTAAAAGTGGGACGAGGGGTTCGTCAAGGGGACCCTCTGTCGCCGATACTCTTCAACGTGGTGATGGACCTCATCCTGGCTTCCCTGCCGGAGAGGGTCGGGTATAGGTTGGAGATGGAACTCGTGTCCGCTCTGGCCTATGCTGACGACCTAGTCCTGCTTGCGGGGTCGAAGGTAGGGATGCAGGAGTCCATCTCTGCTGTGGACTGTGTCGGTAGGCAGATGGGCCTACGCCTGAATTGCAGGAAAAGCGCGGTTCTGTCTATGATACCGGATGGCCACCGCAAGAAGCATCACTACCTGACTGAGCGAACCTTCAATATTGGAGGTAAGCCGCTCAGGCAGGTGAGTTGTGTTGAGCGGTGGCGATATCTTGGTGTCGATTTTGAGGCCTCTGGATGCGTGACATTAGAGCATAGTATCAGTAGTGCTCTGAATAACATCTCAAGGGCACCTCTCAAACCCCAACAGAGGTTGGAGATTTTGAGAGCTCATCTGATTCCGAGATTCCAGCACGGTTTTGTGCTTGGAAACATCTCGGATGACCGATTGAGAATGCTCGATGTCCAAATCCGGAAAGCAGTCGGACAGTGGCTAAGGCTACCGGCGGATGTGCCCAAGGCATATTATCACGCCGCAGTTCAGGACGGCGGCTTAGCGATCCCATCGGTGCGAGCGACCATCCCGGACCTCATTGTGAGGCGTTTCGGGGGGCTCGACTCGTCACCATGAGATTAA
Protein
MMVKRRWHGEESTSSLAPRPGCSLSGVSARVETSLARFQGLEELWKRLRDNGGGSLIGHWCKRTLPDLVPSRVPRQGGCSAEPDFRRASGAEEAGEERCAEDAAAYDPSAVGQMSPDAARVLSELLEGSGRRRACRAMRPKTAGRRNDLHDDRTASAHKTSRQKRRAEYARVQELYKKCRSRAAAEWRAVPVHLKAEMFNAWMARGEIPEILRQCRTVFVPKVERPGGPGEYRPISIASIPLRHFHSILARRLLACCPPDARQRGFICADGTLENSAVLDAVLGDSRKKLRECHVAVLDFAKAFDTVSHEALVELLRLRGMPEQFCGYIAHLYDTASTTLAVNNEMSSPVKVGRGVRQGDPLSPILFNVVMDLILASLPERVGYRLEMELVSALAYADDLVLLAGSKVGMQESISAVDCVGRQMGLRLNCRKSAVLSMIPDGHRKKHHYLTERTFNIGGKPLRQVSCVERWRYLGVDFEASGCVTLEHSISSALNNISRAPLKPQQRLEILRAHLIPRFQHGFVLGNISDDRLRMLDVQIRKAVGQWLRLPADVPKAYYHAAVQDGGLAIPSVRATIPDLIVRRFGGLDSSPXD

Summary

Pfam
PF00078   RVT_1
Interpro
IPR013087   Znf_C2H2_type        + More
IPR000477   RT_dom       
IPR001005   SANT/Myb       

Ontologies

Topology

Length:
594
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00740999999999998
Exp number, first 60 AAs:
0.00022
Total prob of N-in:
0.00259
outside
1  -  594
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号