SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16865
Pre Gene Modal
BGIBMGA014468
Annotation
PREDICTED:_uncharacterized_protein_LOC106708099_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 3.414
 

Sequence

CDS
ATGGCACCCGTAATCCCTGAAATAACATTACCCGCGTCTGCAGAGGACATAAACAGTAGGGACACATACCTCGAAACCGTCCGTAAGCTCATATCCTGCATCACAACAGCTGTGACTGAGGGAAAAAGTGTTACCGCAGCTAACAAGCGCCTTATCTGCTCCGCGGCGGAGGAAATTCGTAGGGCGACGAGAGTGTTGGAAACAACACTCGCATCGACACTGACACCACCAACCCCCTCTCCACCTGCCACCAACGAAGGTTTGAAGGAGGAGATTATCGCTTGCGTCAGAGAGGAGTTCAAGCGGCATAGACAACTACCGCCGCTGACCCTTCAATCACAAGTTCGCCCATCGTATGCCCAAGCCGCAGCACCCAACCCCCGGAAACCAGCCCTTACGACCAAACCAACACCCAAAACATATCCAGCTACAAAACCTGCAATTATTGTCTCAGCAAAAACCGAAGTAAAGACGAAACAGGATATTATCGAGGCCTGGAGGCGCAACATCAGCTTCAAAAATTCCGGCTTTGCCCCTAGCAGAGTACAAGCTGTATCAAATAACAAACTAAGAATCGAGTTCGATAACATAGAACAAAGGAACGATACCCTCACTCGTATCACTAACTCCCAGACAATTCACGCCGAACCCGCTCGCAGGCTGCTGCCTATGCTCAATCTCAAGGGAGTCTCCAAAGACGTTCCCGCTGAAGATCTAGTGAGCATAATCAGCAGACAGAACCCGGAACTCACTAACGCAATCAACCAAAAGGAGGACTTGCGGTTTCGTTTCCAGCGCTCCAACAGAAACCCCAACTTATATAACGCCATCCTAATTGCACAGCCAACTGTCTGGCGTAAGTGTATAAGCCTGGGCAGAATCAGTGTGGACCATCAACGTATTCACGTAGAGGAGTTCACACCGTTCCTGCAGTGTCACAAGTGCCTTAGCTTCGGCCACACTAAAAACAAGTGTTCGTCCACCGAACAATACTGTGCACACTGCAGCGCAAATAACGAGGTCAAAAACATCCCCGGAATTAACATTTACCAATTCTCTGACGGCGCGCGTGTCAAGGCCTGCATACTAGCTAAGACAGGTGTCGGCTCAGTCCTCGGCCTATCCCAATACTCTTCGGCAAACCTGTCGGTCATACAGCTAACGGCAGGAAACAAGAAGACGTACATAGCCTCAACGTACATCGAACCCGATGTCGATGCCAACGGCACCATGGAGCGTCTGGAAGTTTTCCTTAAAGACATAGGAGGGGCGAGAGAGACACTCCAACCTTTCGAAACCATCACTCATGGCCGCAATAGATCATCCATCATCGACCTTACTCTTGCATCCAGCGACCTCTTCAACAGCATCTCTGAATGGCACGTAAATCTTAACACATGCCCCACCTCCCAACACAACGCCATTGAATTCTCACTTAACACCAACGAAAACACAAATAAACACGCAGAAAACACTTCCACATTCCTATACAAGTCGGAACAAGCCAATTGGACAATATTTAGAAACACCCTCCACACTCTTATGGCCAACACAGACATCCTTGATAGGAGCGTTGAAAGCTTAAGCCCAGAGGGACTTGAGTCGCTCCTTCGGGAAGTCACGGACATCCTACACCGGGCCTGTAGGGCATCGATGCGAGTAAAAGCAGGCTCTGGGAATAGACACAAGCCGCCTTGGTGGAACGATCGTCTTCAGGACCTTAAAAACGAGGTAATCAACGTACATCGCAGATTACGTGCGCGCAAGAGACAGAACCTACCATTGGATGACCTCATAGAGCAACAGCAGACGAAAAAAGCCCTATACGCCGATGCCCTACGTGCAGAGTCGACGAGAAGCTTCCGCAGCTTCTGTGAATTACAAACGAAGGAAAATGTATGGTCACTCACCAACAGACTTTTAAAGGAATCCACCCCTAAACGGCCACCAGCTACTCTTAAGACTGGAAATACATTCACCACCTGTGCAAAAGAGACGGCGGAGGCTCTCTTAGAGCACTTTTACCCTGCTGACACTCCAGACACCATAGCACGACATCACCAACTTCGCGCATGCTACGACGCTCCCGTAGACACTGAAAATGACCTACCATTCACCGAGAGGAGGAGCCCGGTAAAAAGCGACCACACAATCTCTCACCTCATTCCGACCCATTGGACTCATCCCCGTCCTTGGAAAGCTCCTCGAAAAACTGATCACCATTACGGATTATGCATTGGGCATCTGTCACAGGAAGGAGCAGTCAACGACAGTTCGGCCTTCAAGGAGCAAACCGGCACGGTCGACGCCATTAACACCCTGATAGACACTATACGAAAAGCCAAACAAGAGAGGTCACAGTTGTCGCCGTCTCGCTCGACATCAGGGCGGCTTTTGATAACGCCTGGTGGGCCGGTCCTATTACACCGCCTTAGAGATATACGATGCCCCAAAAATATCTACGGCCTCATCAAGAGCTACCTCCGAGACAGGCGCGTCGTTCTGGACCACGGAGGAGTTCGCGTCTCCAGAGCCACGTCAAAAGGTTGCGTTCAGGGCTCGGTGTGCGGGCCTGCATTGTGGAACATCATACTTGATGAACTATTGGAGATCCATCTACCATCTGGATGCCACATGCAGGCCTACGCAGACGATGTGGTACTCGTGGTCACCGCCGAAAATGTCAATCGCCTAGAGGAGCTCACCGACACGGTTCTCCAACAGATAGTGAATTGGGGAAAAAGCGTCAAGCTCGAATTCGGGGCCTCCAAAACACAACTGATCGCCTTCACCCCCAAGGCCAGAACTCTTAGGGTGGAGATGGACGGTCAAATCTTAAAAACCTGTAAGGAGATCAAGCTCCTCGGAATAATTTTGGACGAAAAGCTACTCTTTGGCCGCCATGTACAGTACGTCCTGGGAAAGCCTCGCGAATATTCAACAAACTGTGCTTGTACTCCCGACCAACTGGGGTGCTCATCCCGAGAACGTGCGCACCATCTATCTCCGAGTCATCGAGCCAATCGTCACCTACGCTGCCGGGGTGTGGGGACACATAGTAAACAAGCGCTACATCAAAAAATCTTTGATGAGCATGCAGCGTGGTTTTGCCCTAAAAGCCATCAGAGGATTCCGCACTATTTCAACCTCCGCTGCTCTGGCTCTCGCACAATTCACCCCTCTAGACCTAAAAATCCGAGAAGTACACCAAATCGAAAAATTGGAGCCGCATTCGTGCTTTACAGACCCGGCGACACTGAAATATCCGTAACAAAAAAGTACAAATTACACAGTAGCTGCACAGTCTTCCAGGCAGAGCTGTACGCCATCTGGAAAGCCTGTCAGTGGATTGTAAGCGAAAATCATCCCCACACATACATCTTCACCGATTCTCTCTCATCAATATACGCGATAAATAACAGAAGCAACACACACCCCATCATAGTGAACATACACAAACTCATACACGCTAACCACACTACACACAAAATTTTCATAGACTGGGTAAAGGGACACTCGGGTGTCATAGGAAACGAGGAAGCCGATGCGGCTGCCAACAGCGGCGCACGCATGCACAAGGCCCCCGACTACTCGCAGTTCTCAATATCCTACGTGAAACACAAGATTCACACAGAACACCACGCCATCTGGCAAGCCAGATACGAAAGCTCCCCGCAGGGCTCACACACAAAAACACTACTACCAAAACTGAACGACATCAAAGAACTCAACAAATGCACACAAAACAACTTTCAGCTTACACAAATACTCACAGGCCATGGATATCACAAGACATACTTACATCGCTTCAAAATAGCACCAGATGACACCTGCCCCTGCGACGGCACTTCCAGCCAAACTGTAGAACACCTCCTTAAAAACTGCCAAGTGTTCGCTGCGAAAAGGCACAGCCACGAAGAAACGTGCCACGAAGTACAGGTGTCACCATATAATTTACCTGAAATGTTAAAAAAGAAAGCTGCAATCAACTCTTTCACTTCGTTTGCCAAACAATAA
Protein
MAPVIPEITLPASAEDINSRDTYLETVRKLISCITTAVTEGKSVTAANKRLICSAAEEIRRATRVLETTLASTLTPPTPSPPATNEGLKEEIIACVREEFKRHRQLPPLTLQSQVRPSYAQAAAPNPRKPALTTKPTPKTYPATKPAIIVSAKTEVKTKQDIIEAWRRNISFKNSGFAPSRVQAVSNNKLRIEFDNIEQRNDTLTRITNSQTIHAEPARRLLPMLNLKGVSKDVPAEDLVSIISRQNPELTNAINQKEDLRFRFQRSNRNPNLYNAILIAQPTVWRKCISLGRISVDHQRIHVEEFTPFLQCHKCLSFGHTKNKCSSTEQYCAHCSANNEVKNIPGINIYQFSDGARVKACILAKTGVGSVLGLSQYSSANLSVIQLTAGNKKTYIASTYIEPDVDANGTMERLEVFLKDIGGARETLQPFETITHGRNRSSIIDLTLASSDLFNSISEWHVNLNTCPTSQHNAIEFSLNTNENTNKHAENTSTFLYKSEQANWTIFRNTLHTLMANTDILDRSVESLSPEGLESLLREVTDILHRACRASMRVKAGSGNRHKPPWWNDRLQDLKNEVINVHRRLRARKRQNLPLDDLIEQQQTKKALYADALRAESTRSFRSFCELQTKENVWSLTNRLLKESTPKRPPATLKTGNTFTTCAKETAEALLEHFYPADTPDTIARHHQLRACYDAPVDTENDLPFTERRSPVKSDHTISHLIPTHWTHPRPWKAPRKTDHHYGLCIGHLSQEGAVNDSSAFKEQTGTVDAINTLIDTIRKAKQERSQLSPSRSTSGRLLITPGGPVLLHRLRDIRCPKNIYGLIKSYLRDRRVVLDHGGVRVSRATSKGCVQGSVCGPALWNIILDELLEIHLPSGCHMQAYADDVVLVVTAENVNRLEELTDTVLQQIVNWGKSVKLEFGASKTQLIAFTPKARTLRVEMDGQILKTCKEIKLLGIILDEKLLFGRHVQYVLGKPREYSTNCACTPDQLGCSSRERAHHLSPSHRANRHLRCRGVGTHSKQALHQKIFDEHAAWFCPKSHQRIPHYFNLRCSGSRTIHPSRPKNPRSTPNRKIGAAFVLYRPGDTEISVTKKYKLHSSCTVFQAELYAIWKACQWIVSENHPHTYIFTDSLSSIYAINNRSNTHPIIVNIHKLIHANHTTHKIFIDWVKGHSGVIGNEEADAAANSGARMHKAPDYSQFSISYVKHKIHTEHHAIWQARYESSPQGSHTKTLLPKLNDIKELNKCTQNNFQLTQILTGHGYHKTYLHRFKIAPDDTCPCDGTSSQTVEHLLKNCQVFAAKRHSHEETCHEVQVSPYNLPEMLKKKAAINSFTSFAKQ

Summary

Uniprot
ProteinModelPortal
PDB
2QKK     E-value=0.000173953,     Score=112

Ontologies

Topology

Length:
1338
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00039
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  1338
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号