SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16838
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.004
 

Sequence

CDS
ATGTCGGAGGAGGAGAGGGAGCTATTTTCCCCTCGGGTCTCTTTGGCGCGCTCGCCGCCTAGGGACCGACTGCACCTCTGCCGGCGCCTATGCCGCCGCCGGCCCCCCCCGGGGGTTAGGGCGGGAGCGGCTATGAGTGCCAAAGGCCGGAGGACCGGCCTGCATATCCCGGTTGCTTCTGGACTGTCGTCCTCGGCGCCTGTCACCCCGGTTGACCCAGTGGCTGGTGTCCCTAGCTTCCCCATTCCTGTTGCGTCGGGGGCTCCGACTGGACCCCTTGATGTAGCAGCGCAGGGGAGGCTGGAGCTGCTCGAGCGGGCAAACCGAGCGGTGCGCGGGATCATGTCGGTGGCGACGGCGGCATCTAAGCTCAATAAGTCGGAGGTCAATCTAATCTCTGAACTCGGTCGCGATATCCTGGCCGTAGTTGGGGCCCTCGGGATCCAGCTCTCTGATAAGGAGCTGGTGGTCGAAAGGCTCCGCTCGGCAGAGGCCTCTGCACGGCGTGACTCCGTGGCGCCTTCGATGGCTGCTGGTGCGGCGCCGGGTCTGGGACTGGGCCTGCGACCTTCGCCACTGTCCTCAGGACGGGCCCTGGTGGGGTCCCGAGTAGCTGTCAATGGCGTGGAGGGCGACCCCTCCTTCGAGGAGGTAATCGAGTGCCTGGCTAGCCAGAACCTCGACCCGGAGGAGTGGCCCCTCACTAGGGTACGAGCGGAGCTCACGGGGGCGTTCAAAAAGGGGAGGCGACAATCCAACAACACTACTGTGGTGTTTAACGCCTCCCCTCGCATCAGGGACGCCCTCGTGAAGATTGGCAGAGTGTATGTGGGGCACTACGTCGGTCGGGGTCAGGAAGTGGCTGACCGCCGCGCCAAGATGGAGGATTTCATTGGGGCGAGGCGGTTGGTCGTCCATAACGCGGATGGCCACCTGCCGACCTTCAGTACGGCGAACGGAGAATCTTATGTCGATGTCACGCTGTCTACGCGGGGAGTACGCGTGTCTGAATGGCGTGTAACTAATGAATCATCGAGCGATCACCGGCTCATTGTGTTTGGGGTGGGGGGCGGTACAACAGGGGAGCGGGACGAGGACGAGGAGGCGCGGAGCGATTTGAGGCCGGGCGAGCCGTGCGCACTGCGTCGGTACCGGGACCGTGGGGTGGATTGGGACCTCTTCAGATCGCGTATCCACGAGCGAATGGGGAGTCTGGACCTCGAGGAACCTGTGGCTGCCCTTTGCGAAAAATTTACCGGGGTTATAACTCGCACAGCTGAAGAATGCTTAGGATCACTGAAAGCAGATAGAACTGACAGGGGTTATGAGTGGTGGACCCCAGTACTCGATAAGCTTAGGGTAGCCCAGGGTAGGGCCAGGCGTCGATGGCAAAAGGCCCGCCGAACGGGGGGTGAGGAAGAGGAGCAGTCTGGGAGAGTCTTCCGCGACCGCAGGCGCGAGTATCGAAGAGCGATGCATGACGCTGAGACCGCCTTTTACCGGGAGATCGCTGAAGGGGGAAACCGTGACCCGTGGGGACTAGCGTATCGGACGGCGAGTGGTAGGCGACGCGCACCAACTAATGTGGTTAACGGGGTGGAGTATGCGGGGCGGTGCTCGGATGATGTGAGTGGGGCCATGCGCACCTTGATGTGGGCGCTGTGTCCGGATGACTATATGTCTCGGGACACTCCGTACCATGCGCGGGTGCGTATCATGGCCGCGCTCCCCCCATCCGGGCGGGACGCAGACCCGCTGAGCAAAGACTCCCTTCGTGCCATAATTGGCTCACTGAAGAATACCGCACCGGGCATCGACGGTTTAACGGCGCGCATTATCAAAAAGGCACTTCCGGCTGCTGAGGCCGAGTTCGTGGCCGTATACGCACGGAATAAGCTCGATTTTGCCCCGGCGAAGTCCCGATGCATAATGCTGAGGGGAAAGTTTCAGCGTCCCCCTATAGTCCGGTACGGCAGTCATGTCATTCGGTTCGAGAACCAGGTGACGGTGTTGGGCGTCGTCTTCGACGATTGCCTCTCTTTCGCGCCGCATGCGGCGGCCATTGGCGAGAGGGCGAGCAGGTGCTTCGGCAAGATGTCTAGAGTTTCGGCTTCGGCTTGGGGGCTGCGATATAGGGCTTTGCGTGTCTTGTACATGGGCACTTATGTTACAACCCTTACCTATGCGGCGGCCGTATGGTATTTGCGGGCTGCTGTGCACGTCGTGCGCAGCGTGCTGCTTAGGACGCAGCGCCCGTCGTTGACGCTGCTAACGAAGGCCTACCGTTCGTGCAGCACGGCTGCTTTGCCGGTGTTGGCGGGCGTCCTGCCGGCGGACCTGGAGGTGACTCGTGCTGGACGGAGGATGCGGGAGTGCGAAGGATTGGCGCGGGAGTTGGCGGCGGAGAGACGACGACGGATCGACGGCGATGTCTTGGTAGTTTGGCAGAACAGGTGGGTGTCTGAGGGTAAGGGGAGGGAACTGTACAAGTTCTTTCCCGATGTTGCGGACAGGAAGAAGGCAACGTGGATGGAGCCGGACTATCAGACCTCGCAGATCCTCACGGGTCATGGGATCTTTAATAAGCGGTTGGCGGATATGCGACTGAGGGAGGGGCATGCTTGCGACTGCGGGGCGGTTGAGGAGGATAGGGACCATGTCCTGTGGGAGTGTCCTCTCTATGACGAAATCCGGGGCAGGATGCTCGATGGAATCTCGCGGTCTGAGGTGGGCCCAGTTTACCACGCGGACCTGGTCAGGGACGAGAAAAATTTTCGGCTCTTGCGCGAGTTCGCGCATACATGGCACACGGCGCGCACTGCGCGCGAATCACGAGGACTGCCTGGCGACGAAGAATGTGGGTGA
Protein
MSEEERELFSPRVSLARSPPRDRLHLCRRLCRRRPPPGVRAGAAMSAKGRRTGLHIPVASGLSSSAPVTPVDPVAGVPSFPIPVASGAPTGPLDVAAQGRLELLERANRAVRGIMSVATAASKLNKSEVNLISELGRDILAVVGALGIQLSDKELVVERLRSAEASARRDSVAPSMAAGAAPGLGLGLRPSPLSSGRALVGSRVAVNGVEGDPSFEEVIECLASQNLDPEEWPLTRVRAELTGAFKKGRRQSNNTTVVFNASPRIRDALVKIGRVYVGHYVGRGQEVADRRAKMEDFIGARRLVVHNADGHLPTFSTANGESYVDVTLSTRGVRVSEWRVTNESSSDHRLIVFGVGGGTTGERDEDEEARSDLRPGEPCALRRYRDRGVDWDLFRSRIHERMGSLDLEEPVAALCEKFTGVITRTAEECLGSLKADRTDRGYEWWTPVLDKLRVAQGRARRRWQKARRTGGEEEEQSGRVFRDRRREYRRAMHDAETAFYREIAEGGNRDPWGLAYRTASGRRRAPTNVVNGVEYAGRCSDDVSGAMRTLMWALCPDDYMSRDTPYHARVRIMAALPPSGRDADPLSKDSLRAIIGSLKNTAPGIDGLTARIIKKALPAAEAEFVAVYARNKLDFAPAKSRCIMLRGKFQRPPIVRYGSHVIRFENQVTVLGVVFDDCLSFAPHAAAIGERASRCFGKMSRVSASAWGLRYRALRVLYMGTYVTTLTYAAAVWYLRAAVHVVRSVLLRTQRPSLTLLTKAYRSCSTAALPVLAGVLPADLEVTRAGRRMRECEGLARELAAERRRRIDGDVLVVWQNRWVSEGKGRELYKFFPDVADRKKATWMEPDYQTSQILTGHGIFNKRLADMRLREGHACDCGAVEEDRDHVLWECPLYDEIRGRMLDGISRSEVGPVYHADLVRDEKNFRLLREFAHTWHTARTARESRGLPGDEECG

Summary

Uniprot
ProteinModelPortal
PDB
2EI9     E-value=7.40435e-36,     Score=381

Ontologies

GO

Topology

Length:
954
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
13.02883
Exp number, first 60 AAs:
0.00098
Total prob of N-in:
0.00091
outside
1  -  954
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号