SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16827
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.751 Peroxisomal   Reliability : 1.431
 

Sequence

CDS
ATGCATGACGCTGAGACCGCCTTTTACCGGGAGATCGCTGAAGGGGGAAACCGTGACCCGTGGGGACTAGCGTATCGGACGGCGAGTGGTAGGCGACGCGCACCAACTAATGTGGTTAACGGGGTGGAGTATGCGGGGCGGTGCTCGGATGATGTGAGTGGGGCCATGCGCACCTTGATGTGGGCGCTGTGTCCGGATGACTATATGTCTCGGGACACTCCGTACCATGCGCGGGTGCGTATCATGGCCGCGCTCCCCCCATCCGGGCGGGACGCAGACCCGCTGAGCAAAGACTCCCTTCGTGCCATAATTGGCTCACTGAAGAATACCGCACCGGGCATCGACGGTTTAACGGCGCGCATTATCAAAAAGGCACTTCCGGCTGCTGAGGCCGAGTTCGTGGCCGTATACGCACGGGGAAAGTTTCAGCGTCCCCCTATAGTCCGGTACGGCAGTCATGTCATTCGGTTCGAGAACCAGGTGACGGTGTTGGGCGTCGTCTTCGACGATTGCCTCTCTTTCGCGCCGCATGCGGCGGCCATTGGCGAGAGGGCGAGCAGGTGCTTCGGCAAGATGTCTAGAGTTTCGGCTTCGGCTTGGGGGCTGCGATATAGGGCTTTGCGTGTCTTGTACATGGGCACTTATGTTACAACCCTTACCTATGCGGCGGCCGTATGGTATTTGCGGGCTGCTGTGCACGTCGTGCGCAGCGTGCTGCTTAGGACGCAGCGCCCGTCGTTGACGCTGCTAACGAAGGCCTACCGTTCGTGCAGCACGGCTGCTTTGCCGGTGTTGGCGGCGTCCTGCCGGCGGACCTGGAGGAAGAAGGCAACGTGGATGGAGCCGGACTATCAGACCTCGCAGATCCTCACGGGTCATGGGATCTTTAATAAGCGGTTGGCGGATATGCGACTGAGGGAGGGGCATGCTTGCGACTGCGGGGCGGTTGAGGAGGATAGGGACCATGTCCTGTGGGAGTGTCCTCTCTATGACGAAATCCGGGGCAGGATGCTCGATGGAATCTCGCGGTCTGAGGTGGGCCCAGTTTACCACGCGGACCTGGTCAGGGACGAGAAAAATTTTCGGCTCTTGCGCGAGTTCGCGCATACATGGCACACGGCGCGCACTGCGCGCGAATCACGAGGACTGCCTGGCGACGAAGAATGTGGGTGA
Protein
MHDAETAFYREIAEGGNRDPWGLAYRTASGRRRAPTNVVNGVEYAGRCSDDVSGAMRTLMWALCPDDYMSRDTPYHARVRIMAALPPSGRDADPLSKDSLRAIIGSLKNTAPGIDGLTARIIKKALPAAEAEFVAVYARGKFQRPPIVRYGSHVIRFENQVTVLGVVFDDCLSFAPHAAAIGERASRCFGKMSRVSASAWGLRYRALRVLYMGTYVTTLTYAAAVWYLRAAVHVVRSVLLRTQRPSLTLLTKAYRSCSTAALPVLAASCRRTWRKKATWMEPDYQTSQILTGHGIFNKRLADMRLREGHACDCGAVEEDRDHVLWECPLYDEIRGRMLDGISRSEVGPVYHADLVRDEKNFRLLREFAHTWHTARTARESRGLPGDEECG

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03184   DDE_1
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR001878   Znf_CCHC       
IPR005135   Endo/exonuclease/phosphatase       
IPR036875   Znf_CCHC_sf       
IPR036397   RNaseH_sf       
IPR012337   RNaseH-like_sf       
IPR004875   DDE_SF_endonuclease_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
390
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
20.1013
Exp number, first 60 AAs:
0
Total prob of N-in:
0.63817
inside
1  -  208
TMhelix
209  -  231
outside
232  -  390
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号