SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16823  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004585
Annotation
vitellogenin_precursor_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.21
 

Sequence

CDS
ATGGTATTCGAAATTGAAATTGACGGAGGTCGAATCGTAAGCCTCGATTTTCCAACTTCAGTTCCTGTCCCCCAAGAGAATTTAATAAAGGGTCTTATCAGCGCTCTGCAACTTGACACGTCGGCTCACAGAATCATTCACGACTCTCAAAACAACTACGACAGAGAACAGCAACAGGGCCTTTTCAGGAAAATGGAGACTGATGTGACTGGTGATTGTGAGACGCTGTACACGGTATCTCCTGTTGCTTCAGAATGGCGGCGAGAGCTTCCGAAGTTCGCTAACGAACAGGACCCTGTTGAGGTTACAAAGAGCACAAATTACGGTCACTGTCACCACCGGGTCGCTTATCACTTCGGAGTGCCGGTCGGTGCTGAGTGGACTGGAACAGCGCACAAAACCCAAGAACAACAGCTCATTGGCCGCGCTACTTACTCCCGTATCTTAACAGGCAAAGAGGGACCTATTTACAAAGCTGAAACCACGAGCACCGTTCATGTCCACCCTCATCTTTATGGTAAACAGAAAGCCGAAGTATACAGTCACGTCCATATGGAACTGATTTCAGTAGATCAAGACAGTGGGGCTGAATGGCCGAGAGCTGAAGCGATGCGTCCTGCTCAAAGCATTTTATATTCCTTAAGCACAAAACAAATGACTAAGCATTACGAGTCTTCTTCGTCATCGTCTTCTTCGGAATCTCACGAATTCAATTTCCCAGAGCAACACGAACACCCGCATCAGTCCAATCAACGATCGCGTCGTTCTTACATGAGATCTAAATTGGTGACTGTTCACAAAGTACTCAAAAAACGCAACAGCGAAAGCTCGTCTGGTTCTTCAAGTTCAAGTGCGGATTCATCTTCAGCGTACATTAATGATGACATCCCGGACATTGATGAGCCGGCGTATGCAGCATTATATATGAGCCCTCAACCTCACGCGGACAAAAAGCAGAATGCAATGAACGCACAAAAGATTCTTCAAGACATTGCACAACAGTTGCAAAATCCTAATAATATGCCTAAATCTGATTTCCTATCCAAATTTAATATCCTCGTTCGACTTATCGCCAGTATGAGCACCGAACAGCTCAGCCAAACTAGTAGAAGCATTGAAACTGCGAAGACTTCGAACAATATCATTAAATCTGACATGTGGATGATATTCCGTGATGGTGTCACTCAAGCTGCAGCGGACTTGAAAGCATCCGTTGAATATAAAGATAGTACGAAAGCTCAAGTTTACATCAAGCTATTGGTAATTTGGGTCATCGCGAAATACTCAAAGTCTTCGCTCCATATTTGGAAGGAAAAAGTTGAAATATCTACTTATCTTCGCACTCATATTGTGAAGAATTTAAAATCTTTGGCTAAGCTAAGAGATCGGCATGTACGTGCTGTCCTGTTTAGCATTTTAAGAAACACGGCTGAGCCATATCCTGTTAGAGTTGCAGCGATCCAGAGTATATTCATAAGCCACCCCACCGGAGAAATGATGCAAGCTATGGCTGAAATGACCCACAACGATCCAAGTGTAGAAGTTCGGGCTGTTCTTAAGTCCGCCATTTTATCAGCTGCTGAATTACAACACCCACGCAATTTTTATCTATCTAGAACGGCTCAAGCTGCTAGATACTTGGTTACAAATGAAGAATTTGGTTACCAGCATTCATTTAAGTTTATTGATGATAGCTACGACGAAGATAATGACATTGGGACTTTCGTTATTTCCCACATCGGTAGCGAGGATAGTCTTCTGCCAAAAGATTTTAAAATCGTCACCAATTCCAAGGGAGGAGCCTGGGAAAGAAAACACAATTGA
Protein
MVFEIEIDGGRIVSLDFPTSVPVPQENLIKGLISALQLDTSAHRIIHDSQNNYDREQQQGLFRKMETDVTGDCETLYTVSPVASEWRRELPKFANEQDPVEVTKSTNYGHCHHRVAYHFGVPVGAEWTGTAHKTQEQQLIGRATYSRILTGKEGPIYKAETTSTVHVHPHLYGKQKAEVYSHVHMELISVDQDSGAEWPRAEAMRPAQSILYSLSTKQMTKHYESSSSSSSSESHEFNFPEQHEHPHQSNQRSRRSYMRSKLVTVHKVLKKRNSESSSGSSSSSADSSSAYINDDIPDIDEPAYAALYMSPQPHADKKQNAMNAQKILQDIAQQLQNPNNMPKSDFLSKFNILVRLIASMSTEQLSQTSRSIETAKTSNNIIKSDMWMIFRDGVTQAAADLKASVEYKDSTKAQVYIKLLVIWVIAKYSKSSLHIWKEKVEISTYLRTHIVKNLKSLAKLRDRHVRAVLFSILRNTAEPYPVRVAAIQSIFISHPTGEMMQAMAEMTHNDPSVEVRAVLKSAILSAAELQHPRNFYLSRTAQAARYLVTNEEFGYQHSFKFIDDSYDEDNDIGTFVISHIGSEDSLLPKDFKIVTNSKGGAWERKHN

Summary

Pfam
PF00094   VWD        + More
PF09172   DUF1943
PF01347   Vitellogenin_N
Interpro
IPR001747   Lipid_transpt_N        + More
IPR015255   Vitellinogen_open_b-sht       
IPR015816   Vitellinogen_b-sht_N       
IPR015819   Lipid_transp_b-sht_shell       
IPR001846   VWF_type-D       
IPR011030   Lipovitellin_superhlx_dom       
SUPFAM
SSF56968   SSF56968        + More
SSF48431   SSF48431       
Gene 3D

Ontologies

Topology

Length:
607
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00232
Exp number, first 60 AAs:
0.00011
Total prob of N-in:
0.00016
outside
1  -  607
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.000902
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
31223520 FIDDSYDEDNDIGTFVISHIGSEDSLLPK 100.00 1e-16
31223520 FRVEPLHPDQDQTLVHYSVWPYSASQK 100.00 2e-14
31223520 FRVEPLHPDQDQTLVHYSVWPYSASQK 100.00 2e-14
31223520 LYEYLGYWYTEANPLK 100.00 2e-14
31223520 KMETDVTGDCETLYTVSPVASEWRR 100.00 3e-12
31223520 KMETDVTGDCETLYTVSPVASEWR 100.00 6e-12
31223520 KMETDVTGDCETLYTVSPVASEWR 100.00 6e-12
31223520 AEVYSHVHMELISVDQDSGAEWPR 100.00 3e-11
31223520 AEVYSHVHMELISVDQDSGAEWPR 100.00 3e-11
31223520 METDVTGDCETLYTVSPVASEWR 100.00 3e-11
31223520 EGPIYKAETTSTVHVHPHLYGK 100.00 8e-11
31223520 METDVTGDCETLYTVSPVASEWR 100.00 8e-11
29197581 KGQNPEVSGIPSVK 95.83 8e-11
31223520 VIHDSQNNYDREQQQGLFR 100.00 9e-11
31223520 VIHDSQNNYDREQQQGLFR 100.00 9e-11
31223520 EGPIYKAETTSTVHVHPHLYGK 100.00 9e-11
24093152 MEFEITDAR 95.65 2e-10
31223520 MRDMPIATMAPGALSFYQPLK 100.00 1e-08
31223520 VIHDSQNNYDREQQQGLFR 100.00 1e-08
20822545 LENPQHGNFNEQLPDPR 100.00 3e-08
31223520 LENPQHGNFNEQLPDPR 100.00 3e-08
31223520 LENPQHGNFNEQLPDPR 100.00 3e-08
31223520 LENPQHGNFNEQLPDPR 100.00 3e-08
31223520 LENPQHGNFNEQLPDPR 100.00 3e-08
31223520 LENPQHGNFNEQLPDPR 100.00 3e-08
26822097 IDFSYFDR 100.00 3e-08
24093152 VAVSTCHGVR 100.00 3e-08
20822545 VAYHFGVPVGAEWTGTAHK 100.00 2e-06
31223520 VAYHFGVPVGAEWTGTAHK 100.00 2e-06
31223520 VAYHFGVPVGAEWTGTAHK 100.00 2e-06
31223520 VAYHFGVPVGAEWTGTAHK 100.00 2e-06
31223520 VAYHFGVPVGAEWTGTAHK 100.00 2e-06
20822545 YQPTPNIDKVFEIEIDGG 100.00 2e-06
31223520 YLVTNEEFGYQHSFK 100.00 7e-05
31223520 YLVTNEEFGYQHSFK 100.00 7e-05
31223520 YLVTNEEFGYQHSFK 100.00 7e-05
31223520 YLVTNEEFGYQHSFK 100.00 7e-05
31223520 YLVTNEEFGYQHSFK 100.00 7e-05
31223520 YLVTNEEFGYQHSFK 100.00 7e-05
31223520 YLVTNEEFGYQHSFK 100.00 7e-05
20822545 AETTSTVHVHPHLYGK 100.00 2e-04
31223520 LIASMSTEQLSQTSR 100.00 4e-04
31223520 FLDYLRDSVFAPHPK 100.00 4e-04
31223520 LIASMSTEQLSQTSR 100.00 4e-04
31223520 LIASMSTEQLSQTSR 100.00 4e-04
31223520 LIASMSTEQLSQTSR 100.00 4e-04
31223520 LIASMSTEQLSQTSR 100.00 4e-04
31223520 LIASMSTEQLSQTSR 100.00 4e-04
31223520 AETTSTVHVHPHLYGK 100.00 5e-04
31223520 AETTSTVHVHPHLYGK 100.00 5e-04
31223520 AETTSTVHVHPHLYGK 100.00 5e-04
20822545 KIQEEEAAQVVAALPR 100.00 9e-04
31223520 TLAHLQEGPSSGSAFK 100.00 9e-04
31223520 TLAHLQEGPSSGSAFK 100.00 9e-04
31223520 TLAHLQEGPSSGSAFK 100.00 9e-04
31223520 TLAHLQEGPSSGSAFK 100.00 9e-04
31223520 TLAHLQEGPSSGSAFK 100.00 9e-04
31223520 SWHVVMQDESTQR 100.00 0.016
31223520 DGVLVINIEDDRIR 100.00 0.016
31223520 DGVLVINIEDDRIR 100.00 0.016
31223520 ALATQQAYYPEYK 100.00 0.016
31223520 ALATQQAYYPEYK 100.00 0.016
31223520 ALATQQAYYPEYK 100.00 0.016
31223520 ALATQQAYYPEYK 100.00 0.016
20822545 IQHVQVTCKSK 100.00 0.025
31223520 FANEQDPVEVTK 100.00 0.025
31223520 FANEQDPVEVTK 100.00 0.025
31223520 FANEQDPVEVTK 100.00 0.025
31223520 FANEQDPVEVTK 100.00 0.025
31223520 FANEQDPVEVTK 100.00 0.025
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号