SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16820
Annotation
NA
Location in the cell
Nuclear   Reliability : 1.314 PlasmaMembrane   Reliability : 1.325
 

Sequence

CDS
ATGATGACTCTAATGGCGGCTCAGATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATCATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATGATGGCGGCTCAGATGGTGATACTAAAAGCTCACAACATGATGACTCTAATCATGGCGGCTCAGATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATCATGGCGGCTCAGATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATCATGGCGGCTCAGATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATGATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATCATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATCATGGCGGCTCAGATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATCATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATGATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATCATGGCGGCTCAGATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATCATGGTGGCTCAGATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATCATGGCGGCTCAGATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATCATGGCGGCTCAGATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATGATGGCGGCTCAGATGGTGATACTAAAAGCTCACAACATGATGACTCTAATCATGGCGGCTCAGATGGCGGCTCAGATGGTGGTTCTAAAAGCTCACAACATGATGACTCTAATGATGGCGGCTCAGATGGTGGTACTGTAA
Protein
MMTLMAAQMAAQMVVLKAHNMMTLIMAAQMVVLKAHNMMTLMMAAQMVILKAHNMMTLIMAAQMAAQMVVLKAHNMMTLIMAAQMAAQMVVLKAHNMMTLIMAAQMAAQMVVLKAHNMMTLMMAAQMVVLKAHNMMTLIMAAQMVVLKAHNMMTLIMAAQMAAQMVVLKAHNMMTLIMAAQMVVLKAHNMMTLMMAAQMVVLKAHNMMTLIMAAQMAAQMVVLKAHNMMTLIMVAQMAAQMVVLKAHNMMTLIMAAQMAAQMVVLKAHNMMTLIMAAQMAAQMVVLKAHNMMTLMMAAQMVILKAHNMMTLIMAAQMAAQMVVLKAHNMMTLMMAAQMVVL

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
341
Number of predicted TMHs:
9
Exp number of AAs in TMHs:
175.9569
Exp number, first 60 AAs:
28.88132
Total prob of N-in:
0.85412
POSSIBLE N-term signal
sequence
inside
1  -  12
TMhelix
13  -  32
outside
33  -  51
TMhelix
52  -  71
inside
72  -  90
TMhelix
91  -  113
outside
114  -  122
TMhelix
123  -  145
inside
146  -  165
TMhelix
166  -  185
outside
186  -  194
TMhelix
195  -  214
inside
215  -  220
TMhelix
221  -  243
outside
244  -  257
TMhelix
258  -  280
inside
281  -  300
TMhelix
301  -  323
outside
324  -  341
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号