SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16819
Annotation
T18197_reverse_transcriptase-like_protein_-_silkworm
Full name
Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2       + More
Retrovirus-related Pol polyprotein from type-2 retrotransposable element R2DM      
Alternative Name
Retrovirus-related Pol polyprotein from type I retrotransposable element R2
Retrovirus-related Pol polyprotein from type II retrotransposable element R2DM
Location in the cell
Cytoplasmic   Reliability : 1.977 Mitochondrial   Reliability : 1.4
 

Sequence

CDS
ATGATGGTGAAGCGGCGGTGGCATGGCGAGGAAATCGACCTCCTCGCTCGCACCGAGGCCAGGTTGCTCGCTGAGCGGGGTCAGTGCTCGGGTGGAGACCTCTTTGGCGCGCTTCCAGGGTTTGGAAGAACTCTGGAAGCGATTAAGGGACAACGGCGGAGGGAGCCTTATCGGGCATTGGTGCAAGCGCACCTTGCCCGATTTGGTTCCCAGCCGGGTCCCTCGTCAGGGGGGTGCTCGGCCGAGCCTGACTTCCGGCGGGCTTCTGGAGCTGAGGAAGCGGGCGAGGAACGATGCGCCGAAGACGCCGCTGCCTATGATCCATCCGCAGTCGAGTACGCGCGTGTGCAGGAACTGTACAAGAAGTGTCGCAGCAGAGCAGCAGCTGAGGTGATCGATGGCGCGTGTGGGGGTGTCGGACACTCGCTCGAGGAGATGGAGACCTATTGGCGACCTATCCTCGAGAGAGTGTCCGATGCACCTGGGCCTACACCGGAAGCTCTTCACGCCCTAGGGCGTGCGGAGTTGCACGGGGGCAATCGCGACTACACCCAGCTGTGGAAGCCGATCTCGGTGGAAGAGATCAAGGCCTCCCGCTTTGACTGGCGAACTTCGCCGGGCCCGGACGGTATACGTTCGGGTCAGTGGCGTGCGGTTCCTGTGCACTTGAAGGCGGAAATGTTCAATGCATGGATGGCACGAGGCGAAATACCCGAAATTCTACGGCAGTGCCGAACCGTCTTTGTGCCTAAGGTGGAGAGACCAGGTGGACCGGGGGAATATCGACCGATCTCGATCGCGTCGATTCCCCTGAGACACTTTCACTCCATCTTGGCCCGGAGGCTGTTGGCTTGCTGCCCCCCTGATGCACGACAGCGCGGATTTATCTGCGCCGACGGTACGCTGGAGAATTCCGCAGTACTGGACGCGGTGCTTGGGGATAGCAGGAAGAAGCTGCGGGAATGTCACGTGGCGGTGCTAGACTTCGCCAAGGCATTTGACACAGTGTCTCACGAGGCACTTGTCGAATTGCTGAGGTTGAGGGGCATGCCCGAACAGTTCTGCGGCTACATTGCTCACTTATACGATACGGCGTCCACCACCTTAGCCGTGAACAATGAAATGAGCAGCCCTGTGAAAGTGGGACGAGGGGTTCGTCAAGGGGACCCTCTGTCGCCGATACTCTTCAACGTGGTGATGGACCTCATCCTAGCTTCCCTGCCGGAGAGGGTCGGGTATAGGTTGGAGATGGAACTTGTGTCCGCTCTGGCCTATGCTGACGACCTAGTCCTGCTTGCGGGGTCGAAGGTAGGGATGCAGGAGTCCATCTCTGCTGTGGACTGTGTTGGTAAGCAGATGGGCCTACGCCTGAATTGCAGGAAGAGCGCGGTTCTGTCTATGATACCGGATGGCCACCGCAAGAAGCATCACTACCTGACTGAGCGAACCTTCAATATTGGAGGTAAGCCGCTCAGGCAGGTGAGTTGTGTTGAGCGGTGGCGATATCTTGGTGTCGATTTTGAGGCCTCTGGATGCGTGACATTAGAGCATAGTATCAGTAGTGCTCTGAATAACATCTCAAGGGCACCTCTCAAACCCCAACAGAGGTTGGAGATTTTGAGAGCTCATCTGATTCCGAGATTCCAGCACGGTTTTGTGCTGACCGATTGA
Protein
MMVKRRWHGEEIDLLARTEARLLAERGQCSGGDLFGALPGFGRTLEAIKGQRRREPYRALVQAHLARFGSQPGPSSGGCSAEPDFRRASGAEEAGEERCAEDAAAYDPSAVEYARVQELYKKCRSRAAAEVIDGACGGVGHSLEEMETYWRPILERVSDAPGPTPEALHALGRAELHGGNRDYTQLWKPISVEEIKASRFDWRTSPGPDGIRSGQWRAVPVHLKAEMFNAWMARGEIPEILRQCRTVFVPKVERPGGPGEYRPISIASIPLRHFHSILARRLLACCPPDARQRGFICADGTLENSAVLDAVLGDSRKKLRECHVAVLDFAKAFDTVSHEALVELLRLRGMPEQFCGYIAHLYDTASTTLAVNNEMSSPVKVGRGVRQGDPLSPILFNVVMDLILASLPERVGYRLEMELVSALAYADDLVLLAGSKVGMQESISAVDCVGKQMGLRLNCRKSAVLSMIPDGHRKKHHYLTERTFNIGGKPLRQVSCVERWRYLGVDFEASGCVTLEHSISSALNNISRAPLKPQQRLEILRAHLIPRFQHGFVLTD

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger   Aspartyl protease   Protease  
Feature
chain  Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2
EMBL
M16558    AAB59214.1    AB076841    BAC01114.1    AF436853    AAQ04479.1    + More
GBBI01004849    JAC13863.1    LBMM01006940    KMQ90176.1    GBYB01008309    JAG78076.1    LBMM01007077    KMQ90064.1    AAZX01002322    AAZX01010802    AAZX01015897    GBBI01004906    JAC13806.1    GBBI01004905    JAC13807.1    UFQS01003262    UFQT01003262    SSX15424.1    SSX34793.1    L00950    GGMS01004512    MBY73715.1    GFAC01003453    JAT95735.1    KQ971997    KYB24671.1    GFTR01008394    JAW08032.1    FJ461304    ACJ71597.1    X51967    GBRD01016678    JAG49149.1    GBHO01045037    GBHO01045036    JAF98566.1    JAF98567.1    GFAC01005869    JAT93319.1    GEDV01005279    JAP83278.1    GDHC01017848    JAQ00781.1    ABLF02003433    AB097122    BAC82590.1    AAZX01010801    AAZX01015898    AF015815    AAC34903.1    JN937617    AFO19996.1    JQ082370    AFM44926.1    JN937619    AFO19998.1    AB097121    BAC82589.1    KK855758    PTY23787.1    AAZX01023288    AF015685    AAB94032.1    AAZX01023287    EU854578    ACJ46647.1    AF015819    AAC34906.1    GFWV01007503    MAA32233.1    GFWV01002964    MAA27694.1    GFJQ02001120    JAW05850.1    KJ958674    AIL01110.1    GFWV01012635    MAA37364.1    L00951    GFWV01001114    MAA25844.1    AAZX01024756    AAZX01024918    GFAC01000014    JAT99174.1    GEDV01003881    JAP84676.1    NCKV01006447    RWS23444.1    GBRD01002048    JAG63773.1    LBMM01009160    KMQ88340.1    NCKV01002648    RWS26564.1    NCKV01009665    RWS22147.1    AB097123    BAC82591.1    KF925878    AHN53448.1    JN937618    AFO19997.1    JN937616    AFO19995.1    NCKV01004782    RWS24512.1    GFJQ02003336    JAW03634.1    UZAN01004728    VDP32110.1    AAZX01010936    SAUD01015940    RXG59362.1    GFWV01017530    MAA42258.1    UZAI01021487    VDP55649.1    LBMM01006509    KMQ90547.1    BEZZ01008166    GCC17378.1    GCES01144752    JAQ41570.1    JYDI01000477    KRY44798.1    GCES01136315    JAQ50007.1    GCES01088356    JAQ97966.1    GCES01125908    JAQ60414.1    AHAT01035183    GCES01115013    JAQ71309.1   
Pfam
PF00078   RVT_1        + More
PF00096   zf-C2H2
Interpro
IPR013087   Znf_C2H2_type        + More
IPR000477   RT_dom       
IPR036236   Znf_C2H2_sf       
IPR001005   SANT/Myb       
SUPFAM
SSF57667   SSF57667       
PDB
6AR3     E-value=0.0237032,     Score=90

Ontologies

Topology

Length:
556
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01012
Exp number, first 60 AAs:
0.0014
Total prob of N-in:
0.00414
outside
1  -  556
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号