SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16805
Pre Gene Modal
BGIBMGA008170
Annotation
PREDICTED:_EH_domain-binding_protein_1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.852
 

Sequence

CDS
ATGTCGCAATGGTTCAACCTAGTCAATAAGAAGAACGCACTCCTGAGGAGGCAGATGCAGCTGAACATATTGGAGCAGGAGGAGGACCTGAGCCGCCGCTGCGAGCTGCTGGCGCGCGAGCTGCGCCTCTCCCTCGGCGTCGACGAGTGGAGGAAGACTCCCGGGCAGAAGAGGAGGGAGAGGCTGCTGCTGCAGGAGCTGCTGTCCGCGGTCAACGAGCGAGACCGCCTGGTCCAGGAGATGGACGAGCAGGAGAAAGCGATCGCGGACGACGACGCAATCGAGCGGAACCTGTCGCACGTCGAGATCCAAAGGAAGAACAACTGCATCCTGCAGTAG
Protein
MSQWFNLVNKKNALLRRQMQLNILEQEEDLSRRCELLARELRLSLGVDEWRKTPGQKRRERLLLQELLSAVNERDRLVQEMDEQEKAIADDDAIERNLSHVEIQRKNNCILQ

Summary

EMBL
RSAL01000028    RVE51898.1    KZ150393    PZC71038.1    GDQN01011159    GDQN01010000    + More
GDQN01000303    JAT79895.1    JAT81054.1    JAT90751.1    KQ459386    KPJ01227.1    AGBW02013627    OWR43093.1    BABH01026837    BABH01026838    GEBQ01008782    JAT31195.1    KQ414856    KOC60095.1    LJIG01016247    KRT81175.1    KQ434879    KZC09958.1    KQ435757    KOX75872.1    KZ288430    PBC25844.1    KQ760662    OAD59537.1    KK107139    EZA57698.1    QOIP01000003    RLU24887.1    GEZM01007454    JAV95186.1    GEZM01007456    JAV95184.1    GEZM01007458    GEZM01007457    GEZM01007455    GEZM01007453    GEZM01007452    JAV95188.1    GL888243    EGI64069.1    GECZ01009802    JAS59967.1    ADTU01023744    KB631866    ERL86809.1    KQ979608    KYN20473.1    KQ982944    KYQ49012.1    KQ978324    KYM95107.1    GANO01002547    JAB57324.1    KQ976691    KYM77914.1    GL445407    EFN89625.1    GEBQ01016062    JAT23915.1    GEBQ01022832    JAT17145.1    GBHO01036912    JAG06692.1    KQ981965    KYN31840.1    GL438820    EFN68410.1    GBYB01002219    GBYB01002220    JAG71986.1    JAG71987.1    GECU01005307    JAT02400.1    UFQS01001832    UFQT01001832    SSX12483.1    SSX31926.1    SSX12484.1    SSX31927.1    UFQS01000115    UFQT01000115    SSW99898.1    SSX20278.1    SSW99897.1    SSX20277.1    NNAY01000112    OXU30867.1    NEVH01007815    PNF35624.1    PNF35622.1    PNF35621.1    PNF35623.1    GFTR01008332    JAW08094.1    GECL01002907    JAP03217.1    GBGD01000363    JAC88526.1    APGK01017648    KB740047    ENN81833.1    BT100220    ACY46095.1    KQ971319    EFA00250.2    AY121714    AAM52041.1    AJVK01036445    AJVK01036446    AJVK01036447    AE013599    ACL83137.2    CM000158    KRK00392.1    CM002911    KMY94434.1    KMY94437.1    KMY94429.1    BT099671    AAF57918.3    ACV32771.1    CH954179    KQS62390.1    KQS62391.1    AAS64823.1    KMY94430.1    KQS62394.1    EDV55673.1    KQS62396.1    KRK00389.1    KQS62392.1    KQS62395.1    EDW92205.1    KRK00393.1    KQS62393.1    CH480816    EDW48230.1    AAS64824.2    KRK00390.1    KRK00391.1    KMY94436.1    KMY94435.1    CM000362    EDX07437.1    KMY94428.1    KRK00394.1    AJWK01004552    GBHO01036911    GBRD01001155    JAG06693.1    JAG64666.1    GBHO01036913    GBRD01001153    JAG06691.1    JAG64668.1    GDKW01000208    JAI56387.1    GAMC01010536    JAB96019.1    GFDF01000091    JAV13993.1    GFDF01000090    JAV13994.1    CH478221    EAT33515.1    DS232066    EDS33714.1    GFDL01013105    JAV21940.1    JXUM01062708    JXUM01062709    JXUM01062710    GFDL01013229    JAV21816.1    CH902619    EDV37410.1    KPU76803.1   
Pfam
PF10358   NT-C2        + More
PF12130   DUF3585
PF00307   CH
Interpro
IPR022735   bMERB_dom        + More
IPR019448   NT-C2       
IPR036872   CH_dom_sf       
IPR001715   CH-domain       
IPR029944   EHBP1       
SUPFAM
SSF47576   SSF47576       
Gene 3D

Ontologies

Topology

Length:
112
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.28299
outside
1  -  112
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号