SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16802
Annotation
non-LTR_retrotransposon_R1Bmks_ORF2_protein_[Bombyx_mori]
Full name
Retrovirus-related Pol polyprotein from type-1 retrotransposable element R1      
Alternative Name
Retrovirus-related Pol polyprotein from type I retrotransposable element R1
Location in the cell
Mitochondrial   Reliability : 2.067
 

Sequence

CDS
ATGTGGTTAACGGGGTGGACCGAGTTCGTGGCCGTATACGCACGGTGCGTTGTGGAGGGGACCTTCCCGCCGGTGTGGAAGGATGGCCGCCTACTTGTTCTGCCAAAGGGGAATGGCAGGCCCTTAACGGACCCTAAGGCGTATCGCCCGGTCACCTTGCTGCCGGTCCTGGGAAAGATCTTGGAGAAGGTATTATTGCAGTGTGCTCCTGGCCTCACCCATAGTATTAGTCCGCGCCAGCACGGGTTCTCTCCTGGACGCTCAACGGTGACGGCGCTGCGAACTCTGCTGGACGTGTCGCGCGCCTCGGAGCAGAGGTACGTAATGGCCATATTCTTGGACATCAGTGGAGCTTTCGATAACGCGTGGTGGCCCATGATAATGGTGAAGGCCAAGCGGAACTGTCCGCCCAACATCTATCGGATGCTGACGGACTATTTCCGCGGACGCCGTATTGCCGTTGTCGCGGGGGAATGTGCGGAATGGAAGGTGTCCACGATGGGCTGTCCGCAGGGCTCAGTGCTCGGGCCGACGCTCTGGAACGTTCTGATGGATGACCTGCTCGCCTTGCCGCAGGGGATAGAGGGAACAGAGATGGTCGCCTATGCCGATGACGTGACGGTACTGGTTAGGGGTGACTCACGGGCGCAGCTTGAGAGGAGAGCGCACGCCGTGCTAGGACTCGCAGAGGGGTGGGCGAGCAGGAATAAGCTCGATTTTGCCCCGGCGAAGTCCCGATGCATAATGCTGAGGGGAAAGTTTCAGCGTCCCCCTATAGTCCGGTACGGCAGTCATGTCATTCGGTTCGAGAACCAGGTGACGGTGTTGGGCGTCGTCTTCGACGATTGCCTCTCTTTCGCGCCGCATGCGGCGGCCATTGGCGAGAGGGCGAGCAGGTGCTTCGGCAAGATGTCTAGAGTTTCGGCTTCGGCTTGGGGGCTGCGATATAGGGCTTTGCGTGTCTTGTACATGGGCACTTATGTTACAACCCTTACCTATGCGGCGGCCGTATGGTATTTGCGGGCTGCTGTGCACGTCGTGCGCAGCGTGCTGCTTAGGACGCAGCGCCCGTCGTTGACGCTGCTAACGAAGGCCTACCGTTCGTGCAGCACGGCTGCTTTGCCGGTGTTGGCGGGCGTCCTGCCGGCGGACCTGGAGGTGACTCGTGCTGGACGGAGGATGCGGGAGTGCGAAGGATTGGCGCGGGAGTTGGCGGCGGAGAGACGACGACGGATCGACGGCGATGTCTTGGTAGTTTGGCAGAACAGGTGGGTGTCTGAGGGTAAGGGGAGGGAACTGTACAAGTTCTTTCCCGATGTTGCGGACAGGAAGAAGGCAACGTGGATGGAGCCGGACTATCAGACCTCGCAGATCCTCACGGGTCATGGGATCTTTAATAAGCGGTTGGCGGATATGCGACTGAGGGAGGGGCATGCTTGCGACTGCGGGGCGGTTGAGGAGGATAGGGACCATGTCCTGTGGGAGTGTCCTCTCTATGACGAAATCCGGGGCAGGATGCTCGATGGAATCTCGCGGTCTGAGGTGGGCCCAGTTTACCACGCGGACCTGGTCAGGGACGAGAAAAATTTTCGGCTCTTGCGCGAGTTCGCGCATACATGGCACACGGCGCGCACTGCGCGCGAATCACGAGGACTGCCTGGCGACGAAGAATGTGGGTGA
Protein
MWLTGWTEFVAVYARCVVEGTFPPVWKDGRLLVLPKGNGRPLTDPKAYRPVTLLPVLGKILEKVLLQCAPGLTHSISPRQHGFSPGRSTVTALRTLLDVSRASEQRYVMAIFLDISGAFDNAWWPMIMVKAKRNCPPNIYRMLTDYFRGRRIAVVAGECAEWKVSTMGCPQGSVLGPTLWNVLMDDLLALPQGIEGTEMVAYADDVTVLVRGDSRAQLERRAHAVLGLAEGWASRNKLDFAPAKSRCIMLRGKFQRPPIVRYGSHVIRFENQVTVLGVVFDDCLSFAPHAAAIGERASRCFGKMSRVSASAWGLRYRALRVLYMGTYVTTLTYAAAVWYLRAAVHVVRSVLLRTQRPSLTLLTKAYRSCSTAALPVLAGVLPADLEVTRAGRRMRECEGLARELAAERRRRIDGDVLVVWQNRWVSEGKGRELYKFFPDVADRKKATWMEPDYQTSQILTGHGIFNKRLADMRLREGHACDCGAVEEDRDHVLWECPLYDEIRGRMLDGISRSEVGPVYHADLVRDEKNFRLLREFAHTWHTARTARESRGLPGDEECG

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Endonuclease   Hydrolase   Nuclease   Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Retrovirus-related Pol polyprotein from type-1 retrotransposable element R1
EMBL
AB182560    BAD82946.1    M19755    AAC13649.1    KZ150483    PZC70720.1    + More
FM995623    CAX36788.1    GEDC01005462    JAS31836.1    GEDC01008950    JAS28348.1    GBBI01004973    JAC13739.1    ABLF02007988    ABLF02009571    ABLF02063287    GFTR01008452    JAW07974.1    GGMR01014080    MBY26699.1    ABLF02003402    ABLF02025552    ABLF02031460    ABLF02044302    ABLF02059589    ABLF02065568    ABLF02066832    ABLF02066838    ABLF02011142    GECZ01016512    JAS53257.1    AAZX01006426    ABLF02012116    ABLF02012122    ABLF02012123    ABLF02014981    ABLF02023877    ABLF02059855    ABLF02012872    ABLF02012873    ABLF02012874    ABLF02012875    ABLF02042485    ABLF02014982    AAZX01008070    ABLF02027069    ABLF02027071    ABLF02019947    ABLF02019948    ABLF02039158    ABLF02039161    ABLF02039163    ABLF02053351    KQ972959    EFA12187.2    LBMM01003366    KMQ93606.1    ABLF02008578    ABLF02039177    ABLF02008887    ABLF02020087    ABLF02008516    ABLF02041501    ABLF02008889    ABLF02041820    ABLF02020082    ABLF02020086    ABLF02020092    AAZX01004801    ABLF02010037    ABLF02010039    ABLF02066755    KQ971637    KYB24784.1    L00945    ABLF02007471    ABLF02007472    ABLF02022279    ABLF02010931    ABLF02006737    ABLF02008888    ABLF02016960    ABLF02032572    ABLF02020044    ABLF02012457    ABLF02012458    ABLF02019936    ABLF02057951    ABLF02016436    ABLF02007045    ABLF02012124    ABLF02006947    ABLF02022724    ABLF02055397    ABLF02006133    ABLF02012459    ABLF02010919    ABLF02010923    ABLF02010926    ABLF02010927    ABLF02055406    GFTR01008469    JAW07957.1    GEBQ01012211    JAT27766.1    GALX01005145    JAB63321.1    ABLF02034348    ABLF02004512    ABLF02004513    ABLF02046624    ABLF02049075    ABLF02059998    ABLF02065990    AB090812    BAC57900.1    GU205094    ADC53707.1    GU205093    ADC53706.1    ABLF02005552    ABLF02005553    ABLF02003498    ABLF02003499    ABLF02003500    ABLF02014855    ABLF02016356    ABLF02008331    AAZX01023285    ABLF02019548    ABLF02007852    ABLF02010929    ABLF02005550    ABLF02005551    ABLF02006022    ABLF02006024    ABLF02012453    ABLF02012456    ABLF02012624    KQ972822    KXZ75771.1    GGFL01001583    MBW65761.1    HACL01000281    CFW94575.1    KU543682    AMS38369.1    ABLF02026040    AB090816    BAC57908.1    GGMR01019493    MBY32112.1    GGFL01004044    MBW68222.1    M93691    AAA29365.1    GGFJ01001370    MBW50511.1    GGFJ01001727    MBW50868.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF05485   THAP
PF07707   BACK
PF00004   AAA
PF17862   AAA_lid_3
PF16725   Nucleolin_bd
PF05225   HTH_psq
PF02892   zf-BED
PF05585   DUF1758
PF03564   DUF1759
PF00098   zf-CCHC
PF13966   zf-RVT
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006612   THAP_Znf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR011705   BACK       
IPR003959   ATPase_AAA_core       
IPR027417   P-loop_NTPase       
IPR003960   ATPase_AAA_CS       
IPR031996   NVL2_nucleolin-bd       
IPR041569   AAA_lid_3       
IPR003593   AAA+_ATPase       
IPR038100   NLV2_N_sf       
IPR007889   HTH_Psq       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR003656   Znf_BED       
IPR005312   DUF1759       
IPR008737   Peptidase_asp_put       
IPR026960   RVT-Znf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF52540   SSF52540       
SSF57667   SSF57667       
Gene 3D
PDB
6AR3     E-value=0.000760631,     Score=103

Ontologies

Topology

Length:
559
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
14.92828
Exp number, first 60 AAs:
0.03656
Total prob of N-in:
0.11312
outside
1  -  559
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号