SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16800
Annotation
PREDICTED:_phosphatidylinositol_4-phosphate_5-kinase_type-1_alpha_isoform_X7_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.149
 

Sequence

CDS
ATGCACCAGAAATACGACCTCAAAGGGTCCACGTACAAACGTAAGGCAAGCAAAACAGAACGACAGAAAACCTCACCGACCTACAAGGATCTCGACTTCATGGAGCATCACAACGAGGGGATATTTCTGGAAGCGGACACGTACACGGCTTTGATAAAAACGATGCAGCGTGATTGTCGTGTATTGGAGAGCTTCAAGATCATGGACTACTCCCTCCTGGTCGGCATACATAACTTAGATGACGCCCAGCGCGAGAAGAACGAAGCCAGGAAACTGACGGAATCCGGTCAGAGCGATGGTGAGGATAACGAAGGGGAGACAAGAGAACTGGACTCAATCGAACGAGGTTTAGTAACATAG
Protein
MHQKYDLKGSTYKRKASKTERQKTSPTYKDLDFMEHHNEGIFLEADTYTALIKTMQRDCRVLESFKIMDYSLLVGIHNLDDAQREKNEARKLTESGQSDGEDNEGETRELDSIERGLVT

Summary

EMBL
GAIX01010992    JAA81568.1    NWSH01001293    PCG71816.1    ODYU01001460    SOQ37685.1    + More
KQ460890    KPJ11008.1    RSAL01000127    RVE46519.1    AGBW02015012    OWR40710.1    GECU01028773    JAS78933.1    GECU01032498    JAS75208.1    KQ434899    KZC10869.1    GECU01033960    JAS73746.1    GECU01017421    JAS90285.1    GECU01007856    JAS99850.1    GECU01023736    JAS83970.1    GECZ01026895    JAS42874.1    GEBQ01015681    JAT24296.1    GEBQ01026969    JAT13008.1    GEBQ01029952    JAT10025.1    GEBQ01024748    JAT15229.1    GECZ01020378    JAS49391.1    GEDC01019396    JAS17902.1    GEDC01027902    JAS09396.1    GEDC01003899    JAS33399.1    GEDC01023417    JAS13881.1    KQ791045    OAD47036.1    GEZM01019596    JAV89599.1    KK107874    EZA47349.1    GL436229    EFN72215.1    GEZM01019595    JAV89601.1    MUJZ01060566    OTF71526.1    KQ978642    KYN29517.1    GBYB01010572    JAG80339.1    KQ976881    KYN07602.1    KQ414617    KOC68367.1    KQ976543    KYM81004.1    KQ982562    KYQ54831.1    KQ981993    KYN31003.1    GBYB01010570    JAG80337.1    ADTU01024787    ADTU01024788    AAZX01001175    QOIP01000010    RLU17516.1    GL887655    EGI70484.1    GL448322    EFN84793.1    KZ288247    PBC31176.1    APGK01019954    KB740150    KB632173    ENN81251.1    ERL89576.1    GECU01018178    JAS89528.1    GEBQ01022466    JAT17511.1    AXCN02000829    ATLV01014632    KE524975    KFB39308.1    NEVH01017587    PNF23753.1    PNF23752.1    PNF23750.1    PNF23751.1    PNF23748.1    PNF23746.1    GFTR01006165    JAW10261.1    AXCM01001968    CAQQ02104358    CAQQ02104359    CAQQ02104360    ABJB011030879    DS888631    EEC15479.1    PYGN01000163    PSN52385.1    GBBI01003049    JAC15663.1    KQ971351    KYB26781.1    KYB26780.1    DS235033    EEB10776.1    KYB26783.1    GDKW01003558    JAI53037.1    CH478832    EAT32594.1    MWRG01011824    PRD25763.1    GFXV01006810    MBW18615.1    CH477649    EAT37821.1    KK854080    PUA16071.1    KK853162    KDR10437.1    GGMS01013967    MBY83170.1    DS231957    EDS29006.1    ACPB03000431    ACPB03000432    ABLF02032883    GFDL01016150    JAV18895.1    CVRI01000054    CRL00175.1    CRL00174.1    GFDL01009417    JAV25628.1    KK117706    KFM71211.1    GBBM01006721    JAC28697.1    GAPW01001171    JAC12427.1    GEHC01000741    JAV46904.1    JRES01000644    KNC29670.1    GGFM01003531    MBW24282.1    GBHO01036493    GBHO01031568    GBHO01008263    GBHO01008261    JAG07111.1    JAG12036.1    JAG35341.1    JAG35343.1   
Pfam
PF01504   PIP5K
Interpro
IPR002498   PInositol-4-P-5-kinase_core        + More
IPR023610   PInositol-4-P-5-kinase       
IPR027483   PInositol-4-P-5-kinase_C       
IPR027484   PInositol-4-P-5-kinase_N       
Gene 3D
PDB
5E3U     E-value=3.03867e-29,     Score=313

Ontologies

Topology

Length:
119
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00422
Exp number, first 60 AAs:
0.00062
Total prob of N-in:
0.33312
outside
1  -  119
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号