SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16797
Annotation
uncharacterized_protein_Dyak_GE27431_[Drosophila_yakuba]
Location in the cell
Cytoplasmic   Reliability : 1.547 Nuclear   Reliability : 2.063
 

Sequence

CDS
ATGAAAGGAGCGCAGATCTCGACTCCCATGGAACTGGTGCAGGCTACGACGGCAGCGTGTGACGCTTCTATGCCAAAGCAAAACAACCGCAAGAAGAAAGGAGTCTACTGGTGGAACAAGGAAATTGCGGAAGCAAGGAAGGAGTGTTTGAAATGCCGAAGGAGGGAAAGTAACGAAGAAAATGAACACAAAAAGCAGTATAAGGAAGCGAAACTGGAGCTACAAAGACGAATATGGAAAGCGAAAGACGATAAATGGAGGGAAGTGTGCGAGGAAGTCGACAATGATATATGGGGACTGGGATACAAAAATAGTGTCAAAAAACTACGCGGAAACTCACCGATAAATATGGGCATGGCCCAAATTCAAAGCATAGCTGATGGCCTCTTCCCGGAACACATAGATTTCGAACGGAAAACGAAACCATCACAGGAGTTCCCAGAGCCCAGGGCCCGACCGATTCCGCCGGAGATAGTGACTCTAGCAGTAGCAGTAATTCCAGACAGGATAAGGCTTGTGTTGCAGAAGGTGCTGGAGTCTGGCGTCTTCCCCAACAGCTGGAAAACAGCCAGACTAGTCCTGCTAAGAAAACCAGGCAAAACCGCTGCTGAAGATCCTGCGGGGCACAGGCCGCTATGTCTACTGGACTGCTACGGAAAGCTGCTGGAGTCGCTGATCCTAGCAGAATAG
Protein
MKGAQISTPMELVQATTAACDASMPKQNNRKKKGVYWWNKEIAEARKECLKCRRRESNEENEHKKQYKEAKLELQRRIWKAKDDKWREVCEEVDNDIWGLGYKNSVKKLRGNSPINMGMAQIQSIADGLFPEHIDFERKTKPSQEFPEPRARPIPPEIVTLAVAVIPDRIRLVLQKVLESGVFPNSWKTARLVLLRKPGKTAAEDPAGHRPLCLLDCYGKLLESLILAE

Summary

EMBL
ABLF02041557    ABLF02028779    CH892793    KRK05561.1    KQ972544    KXZ75870.1    + More
AB593323    BAK38643.1    GBRD01017378    JAG48449.1    ABLF02009502    KQ971310    KYB29499.1    AB593327    BAK38648.1    KYB29500.1    KQ973343    KXZ75566.1    ABLF02018808    KQ971675    KYB24771.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    KQ971388    KYB24913.1    KXZ75869.1    GGFJ01001164    MBW50305.1    GGFJ01001165    MBW50306.1    GGMR01011682    MBY24301.1    ABLF02021100    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    GALX01003058    JAB65408.1    AB593325    BAK38646.1    GEZM01076296    JAV63782.1    GGMR01004227    MBY16846.1    GGFJ01001166    MBW50307.1    GGFM01001733    MBW22484.1    GGFM01001554    MBW22305.1    GGFK01007771    MBW41092.1    KU543682    AMS38369.1    GAMC01019173    JAB87382.1    GGFL01001583    MBW65761.1    ABLF02034925    ABLF02007249    GEHC01000915    JAV46730.1    ABLF02019087    ABLF02019088    ABLF02026448    ABLF02049713    GGFJ01001439    MBW50580.1    GAPW01000192    JAC13406.1    GBHO01006398    JAG37206.1    GGFJ01001727    MBW50868.1    ABLF02010223    GGFL01004044    MBW68222.1    GGFL01001916    MBW66094.1    GEHC01000964    JAV46681.1    GFTR01008427    JAW07999.1    GGFJ01001541    MBW50682.1    GALA01001777    JAA93075.1    GGFK01006563    MBW39884.1    GGFK01006866    MBW40187.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GBHO01002406    JAG41198.1    ABLF02023257    GGFK01005660    MBW38981.1    AAZX01012143    AAZX01012194    GGFJ01001454    MBW50595.1    ABLF02018098    GGFJ01001453    MBW50594.1    GGFJ01001369    MBW50510.1    GGFJ01001370    MBW50511.1    GFXV01003903    MBW15708.1    KQ972226    KYB24577.1    GALA01001776    JAA93076.1    LBMM01004262    KMQ92649.1    GGMR01000779    MBY13398.1    GALA01000302    JAA94550.1    KQ971309    EEZ99146.1    GDHF01029467    GDHF01011533    JAI22847.1    JAI40781.1    ABLF02041886    LBMM01004261    KMQ92650.1    ABLF02019402    ABLF02059310    GGMR01006838    MBY19457.1    M93690    AAA29363.1    ABLF02013358    ABLF02013361    ABLF02054869    ABLF02038060    ABLF02038061    ABLF02058893    KQ972774    KXZ75780.1    ABLF02007989    KU543683    AMS38371.1    AAZX01003982    AAZX01005071    AAZX01005686    AAZX01011269    AAZX01017893    AAZX01026102    GGMR01015159    MBY27778.1    ABLF02010355    ABLF02027248    GAKP01002292    JAC56660.1    AB090815    BAC57906.1    ABLF02011238    GDAI01000741    JAI16862.1    GGMR01017503    MBY30122.1    GGMR01003651    MBY16270.1    LBMM01017390    KMQ84101.1    ABLF02014650    ABLF02011183    ABLF02041884    ABLF02018942    ABLF02041885    AB593321    BAK38639.1    KQ972691    KXZ75806.1    ABLF02027243    ABLF02035831    ABLF02050978    ABLF02062611    ABLF02041320    LBMM01007425    KMQ89740.1    LBMM01006954    KMQ90166.1    GGMR01004600    MBY17219.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00098   zf-CCHC
PF05585   DUF1758
PF12017   Tnp_P_element
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR000663   Natr_peptide       
IPR008737   Peptidase_asp_put       
IPR021896   Transposase_37       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
229
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0011
Exp number, first 60 AAs:
0.00017
Total prob of N-in:
0.06669
outside
1  -  229
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号