SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16796
Pre Gene Modal
BGIBMGA004239
Annotation
hypothetical_protein_TcasGA2_TC032967_[Tribolium_castaneum]
Location in the cell
Cytoplasmic   Reliability : 1.837 Nuclear   Reliability : 1.862
 

Sequence

CDS
ATGGACAGCTCGGTGGAAATGGAGGAAGTAAGGGAGGACTTAAAGTCGACAAACTTGATAAAAAAAGTAGACAGCTTGGAGATAAGATCACTGAGACCGATGGGCGGTGGAAACCAGACGGCAACAGTGATCCTGGATGAAGAGGATGCAGGAAGGCTGCTTGCGGGTGGGAAGATAAGAGTAGGGCTAAATATATGCCACATTCATGAAAGAATTGAACTGCTGAGATGCTACCGGTGCTGGGAATATGGCCACAAAGCGGAAAACTGCAACGATAAATATGGACCGAGGGAAAGCCGCGCACGACCTACTTCTGGCAACTGCGAGCAAATGAAAGCGGATCTCGTGATGCTAGCTGAACCCAATAGAAAGCTGGCAAAAGCTGCTGGATGGGAGTGCGACACCAGGGGAGATGCAGCCCTAGTGATTCTTAATAAAACACTGACGGTTTCTGAAATTTATAGGGGGAAGGGATTTGTTGGGTTCAAGATGAAGCACTTTGCCGCGTTCAGCTGTTACATATCTCCCAACTGCAGTTTTGAGGAGTTCAAAGCTGACGTCGATGAGCTTTGGACACTACTTAAAAAACAAAAGACACCGATCCTAGTGGCAGGAGATTTTAACTCTGCATCGAGAGCGTGGGGCAGTAAAGTAACCAACAAAAGGGGCCACTACCTGCTGGAAATGGTGGCGGACCTCGACACTGTCATCATGAATGAAGGCGTGACCCCAACTTTTGAAAGAGGAGACAGAACATCCAGGGCCCGACATCACCATGGCCTCTGA
Protein
MDSSVEMEEVREDLKSTNLIKKVDSLEIRSLRPMGGGNQTATVILDEEDAGRLLAGGKIRVGLNICHIHERIELLRCYRCWEYGHKAENCNDKYGPRESRARPTSGNCEQMKADLVMLAEPNRKLAKAAGWECDTRGDAALVILNKTLTVSEIYRGKGFVGFKMKHFAAFSCYISPNCSFEEFKADVDELWTLLKKQKTPILVAGDFNSASRAWGSKVTNKRGHYLLEMVADLDTVIMNEGVTPTFERGDRTSRARHHHGL

Summary

EMBL
KQ971310    KYB29500.1    KQ972544    KXZ75869.1    KYB29499.1    KQ971388    + More
KYB24913.1    ABLF02009502    KQ973256    KXZ75595.1    AAZX01002194    AAZX01004256    AAZX01005003    AAZX01005163    AAZX01006661    AAZX01014356    AAZX01015316    AAZX01015543    AAZX01015804    AAZX01023675    KXZ75870.1    KQ971308    KYB29553.1    ABLF02027248    ABLF02006527    ABLF02019402    ABLF02059310    ABLF02018098    ABLF02013358    ABLF02013361    ABLF02054869    AAZX01003808    AAZX01004267    AAZX01010366    AAZX01005125    ABLF02009709    ABLF02009711    KQ972691    KXZ75805.1    ACPB03005661    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    ABLF02041886    ABLF02018942    ABLF02041885    ABLF02011183    ABLF02041884    KQ973252    KXZ75596.1    LBMM01003988    KMQ92922.1    ABLF02009991    ABLF02009992    ABLF02054952    LBMM01008902    KMQ88543.1    ABLF02030663    ABLF02041312    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    AAZX01006236    AAZX01011971    AAZX01017287    ABLF02041309    ABLF02055493    ABLF02038948    ABLF02041307    LBMM01006977    KMQ90149.1    ABLF02011238    KQ971869    KYB24708.1    ABLF02004854    ABLF02041317    ABLF02011927    LBMM01005474    KMQ91485.1    EF710639    AGO14404.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00098   zf-CCHC
PF10523   BEN
PF13359   DDE_Tnp_4
PF12017   Tnp_P_element
PF00075   RNase_H
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR001878   Znf_CCHC       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036875   Znf_CCHC_sf       
IPR000477   RT_dom       
IPR000663   Natr_peptide       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR018379   BEN_domain       
IPR021896   Transposase_37       
IPR027806   HARBI1_dom       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=0.00016695,     Score=105

Ontologies

Topology

Length:
261
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00132
Exp number, first 60 AAs:
0
Total prob of N-in:
0.02793
outside
1  -  261
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号