SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16790
Annotation
non-LTR_retrotransposon_R1Bmks_ORF2_protein_[Bombyx_mori]
Full name
Retrovirus-related Pol polyprotein from type-1 retrotransposable element R1      
Alternative Name
Retrovirus-related Pol polyprotein from type I retrotransposable element R1
Location in the cell
Nuclear   Reliability : 0.987
 

Sequence

CDS
ATGTCGGTGGCGACGGCGGCATCTAAGCTCAATAAGTCGGAGGTCAATCTAATCTCTGAACTCGGTCGCGATATCCTGGCCGTAGTTGGGGCCCTCGGGATCCAGCTCTCTGATAAGGAGCTGGTGGTCGAAAGGCTCCGCTCGGCAGAGGCCTCTGCACGGCGTGACTCCGTGGCGCCTTCGATGGCTGCTGGTGCGGCGGCCGGGTCTGGGACTGGGCCTGCGACCTTCGCCACTGTCCTCAGGACGGGCCCTGGTGGGGTCCCGAGGTCCATTGGGGCCTCTCAGGGGCCTTCCTTGGCATTCTACCCGTCCGAGGGCAATGCGGAACTGAAGACAGCTGAGGACACAAAGAAAGAGGAAGGTTGGGAATGCGGGGGTAGTGGTGCAGACCACGTCCCCGCGGCCGCAGTCAAGCTTAGAAATGCTGCCCCGCCATCACTGAGAGTCACCGAACCCAGGCGCCGACAGCCCTTAGTAGCTGTCAATGGCGTGGAGGGCGACCCCTCCTTCGAGGAGGTAATCGAGTGCCTGGCTAGCCAGAACCTCGACCCGGAGGAGTGGCCCCTCACTAGGGTACGAGCGGAGCTCACGGGGGCGTTCAAAAAGGGGAGGCGACAATCCAACAACACTACTGTGGTGTTTAACGCCTCCCCTCGCATCAGGGACGCCCTCGTGAAGATTGGCAGAGTGTATGTGGGGTCGAGTATGGATATTAGGCCCCGACTTCGTATTGGCCAAATCAATCTGGGTGGTGCAGAGGATGCGACGAGGGAGCTACCCTCCATTGCACGGGATCTCGGCCTGGATATTGTTCTTGTACAGGAACAATATTCCATGGTCGGGTTCCTAGCCCAATGTGGAGCACACCCCAAGGCGGGTGTGTATATCCGCAATAGGGTGCTCCCCTGCGCGGTTCTGCACCACCTTAGCAGCACACATATAACGGTAGTGCACATTGGGGGGTGGGACTTATATATGGTGTCTGCGTACTTCCAGTATAGTGACCCTATTGACCCATACCTGCACCGGCTCGGGAATATTCTTGACCGGCTGCGGGGGGCTCGGGTCGTTATCTGCGCAGACACTAATGCCCACTCGCCATTGTGGCACTCGCTGCCCAGGCACTACGTCGGTCGGGGTCAGGAAGTGGCTGACCGCCGCGCCAAGATGGAGGATTTCATTGGGGCGAGGCGGTTGGTCGTCCATAACGCGGATGGCCACCTGCCGACCTTCAGTACGGCGAACGGAGAATCTTATGTCGATGTCACGCTGTCTACGCGGGGAGTACGCGTGTCTGAATGGCGTGTAACTAATGAATCATCGAGCGATCACCGGCTCATTGTGTTTGGGGTGGGGGGCGGTACAACAGGGGAGCGGGACGAGGACGAGGAGGCGCGGAGCGATTTGAGGCCGGGCGAGCCGTGCGCACTGCGTCGGTACCGGGACCGTGGGGTGGATTGGGACCTCTTCAGATCGCGTATCCACGAGCGAATGGGGAGTCTGGACCTCGAGGAACCTGTGGCTGCCCTTTGCGAAAAATTTACCGGGGTTATAACTCGCACAGCTGAAGAATGCTTAGGATCACTGAAAGCAGATAGAACTGACAGGGGTTATGAGTGGTGGACCCCAGTACTCGATAAGCTTAGGGTAGCCCAGGGTAGGGCCAGGCGTCGATGGCAAAAGGCCCGCCGAACGGGGGGTGAGGAAGAGGAGCAGTCTGGGAGAGTCTTCCGCGACCGCAGGCGCGAGTATCGAAGAGCGATGCATGACGCTGAGACCGCCTTTTACCGGGAGATCGCTGAAGGGGGAAACCGTGACCCGTGGGGACTAGCGTATCGGACGGCGAGTGGTAGGCGACGCGCACCAACTAATGTGGTTAACGGGGTGGAGTATGCGGGGCGGTGCTCGGATGATGTGAGTGGGGCCATGCGCACCTTGATGTGGGCGCTGTGTCCGGATGACTATATGTCTCGGGACACTCCGTACCATGCGCGGGTGCGTATCATGGCCGCGCTCCCCCCATCCGGGCGGGACGCAGACCCGCTGAGCAAAGACTCCCTTCGTGCCATAATTGGCTCACTGAAGAATACCGCACCGGGCATCGACGGTTTAACGGCGCGCATTATCAAAAAGGCACTTCCGGCTGCTGAGGCCGAGTTCGTGGCCGTATACGCACGGTGCGTTGTGGAGGGGACCTTCCCGCCGGTGTGGAAGGATGGCCGCCTACTTGTTCTGCCAAAGGGGAATGGCAGGCCCTTAACGGACCCTAAGGCGTATCGCCCGGTCACCTTGCTGCCGGTCCTGGGAAAGATCTTGGAGAAGGTATTATTGCAGTGTGCTCCTGGCCTCACCCATAGTATTAGTCCGCGCCAGCACGGGTTCTCTCCTGGACGCTCAACGGTGACGGCGCTGCGAACTCTGCTGGACGTGTCGCGCGCCTCGGAGCAGAGGTACGTAATGGCCATATTCTTGGACATCAGTGGAGCTTTCGATAACGCGTGGTGGCCCATGATAATGGTGAAGGCCAAGCGGAACTGTCCGCCCAACATCTATCGGATGCTGACGGACTATTTCCGCGGACGCCGTATTGCCGTTGTCGCGGGGGAATGTGCGGAATGGAAGGTGTCCACGATGGGCTGTCCGCAGGGCTCAGTGCTCGGGCCGACGCTCTGGAACGTTCTGATGGATGACCTGCTCGCCTTGCCGCAGGGGATAGAGGGAACAGAGATGGTCGCCTATGCCGATGACGTGACGGTACTGGTTAGGGGTGACTCACGGGCGCAGCTTGAGAGGAGAGCGCACGCCGTGCTAGGACTCGCAGAGGGGTGGGCGAGCAGGAATAAGCTCGATTTTGCCCCGGCGAAGTCCCGATGCATAATGCTGAGGGGAAAGTTTCAGCGTCCCCCTATAGTCCGGTACGGCAGTCATGTCATTCGGTTCGAGAACCAGGTGACGGTGTTGGGCGTCGTCTTCGACGATTGCCTCTCTTTCGCGCCGCATGCGGCGGCCATTGGCGAGAGGGCGAGCAGGTGCTTCGGCAAGATGTCTAGAGTTTCGGCTTCGGCTTGGGGGCTGCGATATAGGGCTTTGCGTGTCTTGTACATGGGCACTTATGTTACAACCCTTACCTATGCGGCGGCCGTATGGTATTTGCGGGCTGCTGTGCACGTCGTGCGCAGCGTGCTGCTTAGGACGCAGCGCCCGTCGTTGACGCTGCTAACGAAGGCCTACCGTTCGTGCAGCACGGCTGCTTTGCCGGTGTTGGCGGGCGTCCTGCCGGCGGACCTGGAGGTGACTCGTGCTGGACGGAGGATGCGGGAGTGCGAAGGATTGGCGCGGGAGTTGGCGGCGGAGAGACGACGACGGATCGACGGCGATGTCTTGGTAGTTTGGCAGAACAGGTGGGTGTCTGAGGGTAAGGGGAGGGAACTGTACAAGTTCTTTCCCGATGTTGCGGACAGGAAGAAGGCAACGTGGATGGAGCCGGACTATCAGACCTCGCAGATCCTCACGGGTCATGGGATCTTTAATAAGCGGTTGGCGGATATGCGACTGAGGGAGGGGCATGCTTGCGACTGCGGGGCGGTTGAGGAGGATAGGGACCATGTCCTGTGGGAGTGTCCTCTCTATGACGAAATCCGGGGCAGGATGCTCGATGGAATCTCGCGGTCTGAGGTGGGCCCAGTTTACCACGCGGACCTGGTCAGGGACGAGAAAAATTTTCGGCTCTTGCGCGAGTTCGCGCATACATGGCACACGGCGCGCACTGCGCGCGAATCACGAGGACTGCCTGGCGACGAAGAATGTGGGTGA
Protein
MSVATAASKLNKSEVNLISELGRDILAVVGALGIQLSDKELVVERLRSAEASARRDSVAPSMAAGAAAGSGTGPATFATVLRTGPGGVPRSIGASQGPSLAFYPSEGNAELKTAEDTKKEEGWECGGSGADHVPAAAVKLRNAAPPSLRVTEPRRRQPLVAVNGVEGDPSFEEVIECLASQNLDPEEWPLTRVRAELTGAFKKGRRQSNNTTVVFNASPRIRDALVKIGRVYVGSSMDIRPRLRIGQINLGGAEDATRELPSIARDLGLDIVLVQEQYSMVGFLAQCGAHPKAGVYIRNRVLPCAVLHHLSSTHITVVHIGGWDLYMVSAYFQYSDPIDPYLHRLGNILDRLRGARVVICADTNAHSPLWHSLPRHYVGRGQEVADRRAKMEDFIGARRLVVHNADGHLPTFSTANGESYVDVTLSTRGVRVSEWRVTNESSSDHRLIVFGVGGGTTGERDEDEEARSDLRPGEPCALRRYRDRGVDWDLFRSRIHERMGSLDLEEPVAALCEKFTGVITRTAEECLGSLKADRTDRGYEWWTPVLDKLRVAQGRARRRWQKARRTGGEEEEQSGRVFRDRRREYRRAMHDAETAFYREIAEGGNRDPWGLAYRTASGRRRAPTNVVNGVEYAGRCSDDVSGAMRTLMWALCPDDYMSRDTPYHARVRIMAALPPSGRDADPLSKDSLRAIIGSLKNTAPGIDGLTARIIKKALPAAEAEFVAVYARCVVEGTFPPVWKDGRLLVLPKGNGRPLTDPKAYRPVTLLPVLGKILEKVLLQCAPGLTHSISPRQHGFSPGRSTVTALRTLLDVSRASEQRYVMAIFLDISGAFDNAWWPMIMVKAKRNCPPNIYRMLTDYFRGRRIAVVAGECAEWKVSTMGCPQGSVLGPTLWNVLMDDLLALPQGIEGTEMVAYADDVTVLVRGDSRAQLERRAHAVLGLAEGWASRNKLDFAPAKSRCIMLRGKFQRPPIVRYGSHVIRFENQVTVLGVVFDDCLSFAPHAAAIGERASRCFGKMSRVSASAWGLRYRALRVLYMGTYVTTLTYAAAVWYLRAAVHVVRSVLLRTQRPSLTLLTKAYRSCSTAALPVLAGVLPADLEVTRAGRRMRECEGLARELAAERRRRIDGDVLVVWQNRWVSEGKGRELYKFFPDVADRKKATWMEPDYQTSQILTGHGIFNKRLADMRLREGHACDCGAVEEDRDHVLWECPLYDEIRGRMLDGISRSEVGPVYHADLVRDEKNFRLLREFAHTWHTARTARESRGLPGDEECG

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Endonuclease   Hydrolase   Nuclease   Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Retrovirus-related Pol polyprotein from type-1 retrotransposable element R1
EMBL
AB182560    BAD82946.1    M19755    AAC13649.1    GEDC01008950    JAS28348.1    + More
GEDC01005462    JAS31836.1    GBBI01004973    JAC13739.1    GFTR01008452    JAW07974.1    AAZX01006426    LBMM01003366    KMQ93606.1    ABLF02039177    ABLF02012872    ABLF02012873    ABLF02012874    ABLF02012875    ABLF02042485    AAZX01008070    ABLF02003402    ABLF02025552    ABLF02031460    ABLF02044302    ABLF02059589    ABLF02065568    ABLF02066832    ABLF02066838    ABLF02010931    GFTR01008469    JAW07957.1    ABLF02008888    ABLF02016960    ABLF02032572    ABLF02007045    ABLF02027069    ABLF02027071    ABLF02012124    ABLF02016436    ABLF02007471    ABLF02007472    ABLF02019936    ABLF02057951    ABLF02012458    ABLF02012459    ABLF02010919    ABLF02010923    ABLF02006133    L00945    ABLF02008889    ABLF02041820    ABLF02010037    ABLF02010039    ABLF02066755    ABLF02008887    ABLF02020087    ABLF02012457    ABLF02020044    ABLF02004774    ABLF02008516    ABLF02041501    ABLF02022279    ABLF02020082    ABLF02020086    ABLF02020092    ABLF02010929    ABLF02019664    ABLF02034348    KK119855    KFM76920.1    ABLF02004512    ABLF02004513    ABLF02046624    ABLF02049075    ABLF02059998    ABLF02065990    AB046668    BAB21511.1    ABLF02008515    ABLF02013103    ABLF02013105    ABLF02013107    ABLF02061460    ABLF02004773    KQ972822    KXZ75771.1    ABLF02003498    ABLF02003499    ABLF02003500    ABLF02014855    ABLF02016356    KU543682    AMS38369.1    ABLF02007851    ABLF02016357    ABLF02064424    AB090812    BAC57900.1    KP771712    AKU04650.1    GGFL01004044    MBW68222.1    GDHF01029467    GDHF01011533    JAI22847.1    JAI40781.1    GGFJ01001369    MBW50510.1    GGFJ01001370    MBW50511.1    KU543679    AMS38363.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF00004   AAA
PF17862   AAA_lid_3
PF16725   Nucleolin_bd
PF05485   THAP
PF05585   DUF1758
PF03564   DUF1759
PF05225   HTH_psq
PF00075   RNase_H
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR003959   ATPase_AAA_core       
IPR027417   P-loop_NTPase       
IPR003960   ATPase_AAA_CS       
IPR031996   NVL2_nucleolin-bd       
IPR041569   AAA_lid_3       
IPR003593   AAA+_ATPase       
IPR038100   NLV2_N_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR006612   THAP_Znf       
IPR005312   DUF1759       
IPR008737   Peptidase_asp_put       
IPR007889   HTH_Psq       
IPR036397   RNaseH_sf       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR013087   Znf_C2H2_type       
SUPFAM
SSF56219   SSF56219        + More
SSF52540   SSF52540       
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
PDB
6A42     E-value=6.18057e-127,     Score=1168

Ontologies

Topology

Length:
1271
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
13.75398
Exp number, first 60 AAs:
0.03318
Total prob of N-in:
0.01021
outside
1  -  1271
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号