SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16770
Pre Gene Modal
BGIBMGA009767
Annotation
PREDICTED:_phosphatidylinositol_4-phosphate_5-kinase_type-1_gamma_isoform_X1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.136
 

Sequence

CDS
ATGCTTCTACTGTGTTCCAGGCATCCAGCACGCTATAGGAGGCCTAGCGTCGAAGCCCGAACGCGATCTACTCATGCAGGACTTCATGACCGTCGAGACGACGAATTTCCCCCACGAGGGATCGAACCACACGCCCGCCCATCACTATTCCGAGTTCAATTCAAAACGTACGCGCCGATCGCGTTCCGTTACTTCAGAGATTTGTTTGGGATACAGCCGGACGATTTTTTGATGTCAATGTGCAGCGCACCACTCCGCGAGCTCAGCAACCCTGGCGCTTCAGGCAGCATCTTCTATCTGACGAACGACGATGAGTTCATCATAAAGACGGTACAGCACAAGGAGGGGGAGTTTCTGCAGAAACTACTGCCTGGATACTACTTGAACCTCGATCAGAACCCCCGCACGTTATTACCAAAGTTCTTCGGCCTCTATTGCTATCAGTGTAACAGCAAAAACGTGCGTCTGGTCGCCATGAACAATCTGTTGCCTTCGTCGATCAAAATGCACCAGAAATACGACCTCAAAGGGTCCACGTACAAACGTAAGGCAAGCAAAACAGAACGACAGAAAACCTCACCGACCTACAAGGATCTCGACTTCATGGAGCATCACAACGAGGGGATATTTCTGGAAGCGGACACGTACACGGCTTTGATAAAAACGATGCAGCGTGATTGTCGTGTATTGGAGAGCTTCAAGATCATGGACTACTCCCTCCTGGTCGGCATACATAACTTAGATGACGCCCAGCGCGAGAAGAACGAAGCCAGGAAACTGACGGAATCCGGTCAGAGCGATGGTGAGGATAACGAAGGGGAGACCAAGAGAACTGGACTCAATCGAACGAGATCCGAAGCCAGGGAGGATTTCGGGATCCAAGTTAAAAGGACACAATCGATAAACCGACAGCGTCTGGTCGCGCACTCGACAGCCATGGAGAGCATACAGGCGGAAAGCGAGCCCATAGATGAGGAGGAAGATGTCCCGTCCGGCGGCATCCCGGCCCGGAACGCGCGTGGCGAGCGTCTGCTGCTGTTCCTGGGCATCATCGACATACTCCAGTCGTATCGTCTCCGGAAGAAGCTCGAGCACACTTGGAAGAGCATGATACACGATGGCGACACTGTATCGGTCCACAGACCCAGCTTCTACGCTCAGAGATTCTTAGATTTCATGGCTAAAACCGTTTTCAAGAAGATACCTTCGTTGGACCTGCCGGAAATCAAGGGCAACCACAGGAAGTTCCGAACCCTCGTCACTAGTTACATAGCCCTGAAACACTCTCCTTCGAAGCGGAAGAGCATCGCGAAGCCGTCGCGGCCACAAGAGGAAATCGATACGCCAGGACGCTTCATCGGGCGACCTATCAAAGATTACAATCCGGAATATCTGAGACAGGCCCGACTGTCGCCCAGGTCTTCGGTACGTTCTAGCATGAGCGATTTTACCGATACGACCATATCGACGTGGAACCAGCGTCACCCGCCCGCGCCCGCCGAATACCCCTCGGTCCTTTCCGACAGACTGAAAATACTAGACAGGGACAGAATCAATAACTACCAGAGGCGTATCGATTTCGACACCTCGAACTTGACGGCGCGCGATCCGGGACCCTCGTCGGCATTTTACGCCGACAACGCGTACCGGTCCAACGTTCAGGAACGGATGGAGACGCTCTCGAACAGCTGA
Protein
MLLLCSRHPARYRRPSVEARTRSTHAGLHDRRDDEFPPRGIEPHARPSLFRVQFKTYAPIAFRYFRDLFGIQPDDFLMSMCSAPLRELSNPGASGSIFYLTNDDEFIIKTVQHKEGEFLQKLLPGYYLNLDQNPRTLLPKFFGLYCYQCNSKNVRLVAMNNLLPSSIKMHQKYDLKGSTYKRKASKTERQKTSPTYKDLDFMEHHNEGIFLEADTYTALIKTMQRDCRVLESFKIMDYSLLVGIHNLDDAQREKNEARKLTESGQSDGEDNEGETKRTGLNRTRSEAREDFGIQVKRTQSINRQRLVAHSTAMESIQAESEPIDEEEDVPSGGIPARNARGERLLLFLGIIDILQSYRLRKKLEHTWKSMIHDGDTVSVHRPSFYAQRFLDFMAKTVFKKIPSLDLPEIKGNHRKFRTLVTSYIALKHSPSKRKSIAKPSRPQEEIDTPGRFIGRPIKDYNPEYLRQARLSPRSSVRSSMSDFTDTTISTWNQRHPPAPAEYPSVLSDRLKILDRDRINNYQRRIDFDTSNLTARDPGPSSAFYADNAYRSNVQERMETLSNS

Summary

EMBL
KQ460890    KPJ11008.1    ODYU01001460    SOQ37685.1    RSAL01000127    RVE46519.1    + More
KQ978642    KYN29517.1    GL436229    EFN72215.1    NWSH01001293    PCG71816.1    GL887655    EGI70484.1    KQ414617    KOC68367.1    NEVH01017587    PNF23746.1    QOIP01000010    RLU17516.1    ADMH02001355    ETN62891.1    CVRI01000054    CRL00175.1    CRL00174.1    GDAI01002356    JAI15247.1    UFQT01000988    SSX28303.1    GBBI01003049    JAC15663.1    ACPB03000431    ACPB03000432    GBRD01016232    GBRD01006146    JAG59675.1    GBRD01016231    GBRD01006253    JAG59568.1    SSX28304.1    GDHC01007644    JAQ10985.1    KQ981993    KYN31003.1    KQ982562    KYQ54831.1    GBXI01007986    JAD06306.1    GBRD01004080    GBRD01004077    JAG61741.1    CM002911    KMY95897.1    KMY95901.1    GBRD01004078    GBRD01004075    JAG61743.1    KMY95898.1    KMY95900.1    KMY95899.1    KMY95896.1    CH963846    EDW72306.2    JRES01000644    KNC29670.1    KMY95903.1    CH902619    KPU76940.1    KPU76941.1    AE013599    ABI31111.3    CM000071    ENO01938.2    AFH08224.1    GL448322    EFN84793.1    AAF46919.3    CM000158    KRK00420.1    CH954179    KQS63000.1    OUUW01000001    SPP74643.1    KRK00421.1    KPU76944.1    KQS63006.1    KQS62999.1    KQS63011.1    KRK00411.1    KRK00417.1    GBYB01010570    JAG80337.1    KPU76939.1    CH940648    EDW62082.2    GDHF01024241    GDHF01010699    JAI28073.1    JAI41615.1    KRK00414.1    KQS63008.1    GDHF01029250    JAI23064.1    EDY69499.2    GAKP01015032    JAC43920.1    KRF80430.1    KPU76945.1    GAMC01015559    GAMC01015555    JAB90996.1    ENO01939.2    PNF23751.1    PNF23753.1    KZ288247    PBC31176.1    CP012524    ALC41646.1    GAMC01015557    GAMC01015554    JAB91001.1    GEZM01019595    JAV89601.1    KRK00416.1    PNF23748.1    PNF23750.1    PNF23752.1    KRK00413.1    KRK00419.1    KQS63001.1   
Pfam
PF01504   PIP5K
Interpro
IPR023610   PInositol-4-P-5-kinase        + More
IPR027483   PInositol-4-P-5-kinase_C       
IPR002498   PInositol-4-P-5-kinase_core       
IPR027484   PInositol-4-P-5-kinase_N       
Gene 3D
PDB
5E3U     E-value=5.27845e-115,     Score=1061

Ontologies

Topology

Length:
563
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00193
Exp number, first 60 AAs:
0.00012
Total prob of N-in:
0.00031
outside
1  -  563
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号