SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16767
Annotation
C36329_hypothetical_protein_3_-_cabbage_looper_transposon_TED__(fragment)
Location in the cell
Nuclear   Reliability : 3.385
 

Sequence

CDS
ATGGCCGTAGACCCGGACCAAATCTACAAGGCCCTTCGCCCAGTGCCAGAGTTCGACGGCAATCCGAACATACTGACTAGGTTTATCAGAATTTGTGACCAAATCGTCACGCAGTATATAAGAACAGATCCTGGAAACGAATTAAATAACCTCAGCTTAATAAACGGTATATTAAATAAAATAACTGGTCCTGCCGCCAGGACCATAAATTCAAATGGCATACCAGAGAACTGGTTAGGTATCCGTACTGCCCTCATTAATAATTTTTCAGACCAAAGAGATGAGACCGCTTTGTACAATGACCTCTCCTTACTAACACAGGGAAACAGTAGCCCCCAGGAGTTTTACGACAAATGCCAGACCCTATTCAGCACTCTCATGACATACGTAACTTTACACGAAAGCATTGCCACAACCATCGAGGCAAAACGCGACCTGTATAAAAAGCTAACAATGCAAGCATTTGTTCGAGGCCTCAAGGAACCCTTGGGATCTCGCATACGCTGCATGAGACCGACCTCCATTGAAAAGGCTCTGGAATTTGTACAGGAAGAACTTAACATAATGTATCTACAACAGCGAAACGGGTTCACCTCTGAACGGCGCAACCTTATTCAGCCTACACCGACACCACCTGTAAAAATACCACATATGTTTCCGGTAGCAATGCCGAAACCGCTTTCATTCGGACCGAACCCAGGACCGAGCTGGGAGCGACAGCCACCACCAGGACCTAATAACCACTGGAAATCTGCTTTCAAATTTAACGCCCCTCAGCGCATGCCTAACATGCCATCACGCACGCAGCAAATGTTCGCATCGCACCCACCAAACTACAACCCCCGTAGCAACGTATTTAGGCTACCTCAGCGGAACCAGGGACCGAAACCTATGAGTGGTATTAGTCACTACGTGGCAAAACAACTTCCACTCACAGGTCATGATTGGACTTTTTCAGAACTTAACGACGCGGGACCTATTAAACTGTTTGTCTACGATTTCCACAAATTTTTTGACGGACTTATTGGTTTAGACTTGCTGACTAAATGGAAATCTAGAATCGACCTTAAAGACAACCTACTGATTACAGACAATTCTACCAACCCTATTGAAATGTTCAATTCTCGCAACGTCAACCTGTACGAAGACATCGTACCGGCTAACTCTAGTAAACTAGTTAGAATTCCAATAAATTCATCTGACGGCGAAGTCTATATCCCGCAGCAATACCTGAACAACTGTGTGGTGAACGAATGCATCACGACAGTCGTTAAAAACCGTGTTCATATGGACTTGTTCACCGCCCAATCCGAAAAATACCTGACATTTATTGACGTATTCTCTAAGTACGGACAGGCTTACCTGTTGAGAGACGGCACAGCAATTAGCGTATTACAGGGTCTATTGCAGTTCTGCACGCATCATGGTCTACCTTTAACGATAGTAACTGATAATGGTACAGAATTCACAAACCAATTGTTTTCCGAATTCATACGACTTCACAAAATAAATCATCATAAAACCCTAGCACATACACCTAATGACAATGGCAATGTAGAGAGATTCCATTCAACCTTGCTAGAACACCTTCGCATACTTCGCTTACAACATAAAAATGAACCTGTAATAAACTTAATGCCTTATGCAATATTAGCTTACAACAGTTCAGTCCATAGTTTCACCAAATGTCGCCCTTTTGACATAATAACGGGACACTTTGACCCTAGAGACCCTCTCGACATTGACATAACAGCCCATTTACTGCAACAGTACATGGAATCACATAAAGCTCAAATGACTACAGTTTATGAACTCATAAATGAAACCTCACTTGCTAACCGTACATCGCTCATTGAAAATAGAAATAAGAACCGCGAACCAGAAGCGACGTACCAACCTAACCAACAAGTTTTCATTAAAAACCCGATAGCAGCCCGACAAAAAACAGCCCCGAGGATTCTACTGAACCTCCTGACCCGACATCTGACGACCGCACACGAGATAAAACTTGAGACCCTCGAGAACGGACCTGGACTTTTACCTTTTAAACTCGGACAGACTAGACTCGTATCCCACTATCATTCATTTTTACAATATATAGAATTAGCTGACGTAGATAACAGACTCGACTCAGTACAAACTCAACTAAAATATTTTAAAGACCAACTAGACGAACACACTTATCTCCTTTATGAACTTCAAATAAACTACCTAACTAGCAAAATCACTAAAATCAATTCCAAAATTAACAGCCTCAAACCCAATCGCGTAAAAAGAGGTCTCATTGATGGCTTAGGTTCAATTGTTAAAAGCATTACAGGTAACCTAGACCAGTCAGATGCCGAACTTTACAGTAAAGCTATTAAAATTTTGCAAAATAATGATAATCAGCTATCATCCGAGCTTAACCAATATATTAGTCTGAACAAAGCATGGATGACCGAACATACACAGCTACTTTCCGAAATCGCAAAGAATCAGGAAAAAATTAATGTTACCTTAAGCTGGTTATTAGACAGTAAAATATATGCCGATAGTAATCTGCTTAAATATGCTAAATTCGCCCAGTTATTAGCTATCATTAGTGAAAATATTGAGGATTTATATAACGAATTATGTAGGATTGAAAATATCTTAAGTTTTATCCGTGCATCAAGCACACACCATAGTATGATAAGCATAGATACGTTAAGTAATATGACAGATAGGTTAAGAAATTTATATACGGAAAACCGTATTTTAAACGTAGATTTAAGAGAATATTATAATATTATAAAACCAGGCTATTATTATGTAGGAAAGAAAATAGTTATTGTCTTTAAATTTCCTGTAATTTCTCCGGATGAATTCGAACTATATAAATTAACCATTGCCCCTAATAAGCATCAATTAACTTTCATCCCTCCTTATCCTTTCATCGCAACAAATAAGAAAGCGTTCATGTACATAGAGGCTGAATGCCCGAAGTACAACAGGTACTACCTCTGCGAGGAAAATATAAATCACCAGCCAAGAGATGATCCTGATTGCATCCACGATCTTATCTACAATCAAGCCATGAACACCTCATGCCAGCCAACCTCTGTTTCTTTCACTAAAGAAGCCATGGAACAACTAGACGATAAGCATTACGTCCTTATTTTCCCCGAGACCACGAAGATCGAACTTCATTGTCAACGCCTGGAGTACAGTACGCTTCAAGGAAGTTATCTCGTTACCATTCCGCAAAATTGTAAGCTGCGAACCGGACGACTAACACTGGCAAACAATAATGATCAGATCAACGGACAGCCTCTGAAAATAACTGAAATCCCGAAGGATGCAAAAATCACAGGACCCATTAGACCTCATATCAAGCTCACCTCCTTGAACCTGGAGAAAATACACCAAATCCAGGATGATATAATCCAACAACATCCTGTGGACCTAGAACAAAGTGACGTCACGAACCAAGCACTCTTTCATACGACAATACCTTTTTACGGAGCACTCTGCGGCGCGATTGTCCTAGCTGTTGTAATCGCTGTTCATCGGCACAAGTCTTGCAACATAACCCTGGAAAAGAAGCCACGCGAAGAAACCTCAAAATTTCACCCGTACGAGAGTCCAGAAGAACCCCAGAAGAAGGACCGAATTCCGGCAACATTTGCCCTCAAGATTATCAAATAG
Protein
MAVDPDQIYKALRPVPEFDGNPNILTRFIRICDQIVTQYIRTDPGNELNNLSLINGILNKITGPAARTINSNGIPENWLGIRTALINNFSDQRDETALYNDLSLLTQGNSSPQEFYDKCQTLFSTLMTYVTLHESIATTIEAKRDLYKKLTMQAFVRGLKEPLGSRIRCMRPTSIEKALEFVQEELNIMYLQQRNGFTSERRNLIQPTPTPPVKIPHMFPVAMPKPLSFGPNPGPSWERQPPPGPNNHWKSAFKFNAPQRMPNMPSRTQQMFASHPPNYNPRSNVFRLPQRNQGPKPMSGISHYVAKQLPLTGHDWTFSELNDAGPIKLFVYDFHKFFDGLIGLDLLTKWKSRIDLKDNLLITDNSTNPIEMFNSRNVNLYEDIVPANSSKLVRIPINSSDGEVYIPQQYLNNCVVNECITTVVKNRVHMDLFTAQSEKYLTFIDVFSKYGQAYLLRDGTAISVLQGLLQFCTHHGLPLTIVTDNGTEFTNQLFSEFIRLHKINHHKTLAHTPNDNGNVERFHSTLLEHLRILRLQHKNEPVINLMPYAILAYNSSVHSFTKCRPFDIITGHFDPRDPLDIDITAHLLQQYMESHKAQMTTVYELINETSLANRTSLIENRNKNREPEATYQPNQQVFIKNPIAARQKTAPRILLNLLTRHLTTAHEIKLETLENGPGLLPFKLGQTRLVSHYHSFLQYIELADVDNRLDSVQTQLKYFKDQLDEHTYLLYELQINYLTSKITKINSKINSLKPNRVKRGLIDGLGSIVKSITGNLDQSDAELYSKAIKILQNNDNQLSSELNQYISLNKAWMTEHTQLLSEIAKNQEKINVTLSWLLDSKIYADSNLLKYAKFAQLLAIISENIEDLYNELCRIENILSFIRASSTHHSMISIDTLSNMTDRLRNLYTENRILNVDLREYYNIIKPGYYYVGKKIVIVFKFPVISPDEFELYKLTIAPNKHQLTFIPPYPFIATNKKAFMYIEAECPKYNRYYLCEENINHQPRDDPDCIHDLIYNQAMNTSCQPTSVSFTKEAMEQLDDKHYVLIFPETTKIELHCQRLEYSTLQGSYLVTIPQNCKLRTGRLTLANNNDQINGQPLKITEIPKDAKITGPIRPHIKLTSLNLEKIHQIQDDIIQQHPVDLEQSDVTNQALFHTTIPFYGALCGAIVLAVVIAVHRHKSCNITLEKKPREETSKFHPYESPEEPQKKDRIPATFALKIIK

Summary

Uniprot
ProteinModelPortal
PDB
3JCA     E-value=0.000970334,     Score=105

Ontologies

Topology

Length:
1222
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
21.04102
Exp number, first 60 AAs:
0.00073
Total prob of N-in:
0.00062
outside
1  -  1153
TMhelix
1154  -  1176
inside
1177  -  1222
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号