SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16763
Annotation
non-LTR_retrotransposon_R1Bmks_ORF2_protein_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.774
 

Sequence

CDS
ATGGATTCCCACTGTCCCTATCTACTTTCGGCTTCGGCTTGGGGGCTGCGATATAGGGCTTTGCGTGTCTTGTACATGGGCACTTATGTTACAACCCTTACCTATGCGGCGGCCGTATGGTATTTGCGGGCTGCTGTGCACGTCGTGCGCAGCGTGCTGCTTAGGACGCAGCGCCCGTCGTTGACGCTGCTAACGAAGGCCTACCGTTCGTGCAGCACGGCTGCTTTGCCGGTGTTGGCGGGCGTCCTGCCGGCGGACCTGGAGGTGACTCGTGCTGGACGGAGGATGCGGGAGTGCGAAGGATTGGCGCGGGAGTTGGCGGCGGAGAGACGACGACGGATCGACGGCGATGTCTTGGTAGTTTGGCAGAACAGGTGGGTGTCTGAGGGTAAGGGGAGGGAACTGTACAAGTTCTTTCCCGATGTTGCGGACAGGAAGAAGGCAACGTGGATGGAGCCGGACTATCAGACCTCGCAGATCCTCACGGGTCATGGGATCTTTAATAAGCGGTTGGCGGATATGCGACTGAGGGAGGGGCATGCTTGCGACTGCGGGGCGGTTGAGGAGGATAGGGACCATGTCCTGTGGGAGTGTCCTCTCTATGACGAAATCCGGGGCAGGATGCTCGATGGAATCTCGCGGTCTGAGGTGGGCCCAGTTTACCACGCGGACCTGGTCAGGGACGAGAAAAATTTTCGGCTCTTGCGCGAGTTCGCGCATACATGGCACACGGCGCGCACTGCGCGCGAATCACGAGGACTGCCTGGCGACGAAGAATGTGGGTGA
Protein
MDSHCPYLLSASAWGLRYRALRVLYMGTYVTTLTYAAAVWYLRAAVHVVRSVLLRTQRPSLTLLTKAYRSCSTAALPVLAGVLPADLEVTRAGRRMRECEGLARELAAERRRRIDGDVLVVWQNRWVSEGKGRELYKFFPDVADRKKATWMEPDYQTSQILTGHGIFNKRLADMRLREGHACDCGAVEEDRDHVLWECPLYDEIRGRMLDGISRSEVGPVYHADLVRDEKNFRLLREFAHTWHTARTARESRGLPGDEECG

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
261
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
23.28248
Exp number, first 60 AAs:
22.22123
Total prob of N-in:
0.53803
POSSIBLE N-term signal
sequence
outside
1  -  19
TMhelix
20  -  42
inside
43  -  261
 
 

Population Genetic Test Statistics

Pi
0.993977
Theta
1.325217
Tajima's D
-0.532808
CLR
1.233341
CSRT
0.258637068146593
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号