SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16761
Pre Gene Modal
BGIBMGA005642
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_cytokine_receptor_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.236
 

Sequence

CDS
ATGAAATATGAAATCAGGATCTACATCAAATCTAAAGCTGCAGTGAAAGAAGAGTTTTGGTCAGACTTCACATATACCATGGTATATACACTTAGCGAGAGACCTAGAAGACCACCAGACACCGCAGTTGGAGCCTTTGATCAATCTTTATATCAAACAAATAGAATGATATACATTTATTGGAAACAACTTGAAGAATATGAAGAGGCAGGCCGAATGAACTTCATTGTTTTAAGTGCCAATAAAACAATGCAAGTCATAGAACTACCTAGAGAAAACAGGTATCAGTTTGCCATATCGGCTAATAATGGGACGAAAACTAGTGGCATGGTATGGGCTATCTGTGATATATCTAAAGATGCAATTCCAATGTATGGTTTTCCGGTCAAAATGGACCATGGTATTCCAGGGAAAACTTTTGTAAAGATTAAATGGGCAATGACTTGTACACTTCAAGAAGGAATCATTACAGGATATTTGATCGCATATTGTCCTGCTCTAGATACCACTAATGTTTGTGCAACAAAAAATAAAACTAACTTATACATATCTAATCCTAAGCAAATGGAGATCAACATTACAAATCTTGAACCATACACTACATATATATTTACACTGGCATTGAACACCACTTATGGATTTAAAACAGTAGAAAATGCTTTCACGAGTATGACTACAACTGAAGATACTCCAACTAGTCCAGTTAATATTAATATAACCGATGTGCTTAGTGATTCATTGACGATTTCATGGGACCCACCTATTCATAAAAACGGAGTTATTGGAAAATATGTCATAAATAACTATGGTCAAGAAGTTTATGTAGAAAAAGTTTCAGATAAAGATGAAGATTCAAAAAGAAGGCATATTCGTTTGACTGGCTTACAGGGGTTTACTAATTATTCATTGAGTGTACAAGCATGTAGTACAGCTATAAGCAGTTGTTCGGTTTTGAATCCACATGATGCCCTTTTTGTCAGGACGAGAATAGGTCCTCCTAGTAAAATGAGGGCTCCAACTGTTAAAAATAATCCAGATTTTATTAAGTGGGTTCCACCAATAATACCAGGGGGGACGATTGACCTTTACCAAATTAAAAGGATTAAAGATGAGAGTGAAGCTGAAATAATAAATACTACAAACCTTTCATTTTCATTGATACATTGTGAAGGTGGAGTTGCCGGACAAACTTACCAAGTTAGAGCTGTTAATTTTGATGAAGATCCTTACCACGGTGCTTTAACTGACAATAAGGATGTATACCTACATAATGCTAACTATAAAGGTATACTAGAATATCCTGGAGAATGGAGTGAGCCAAGTTTTGTAAATTGTACAAGCAAAGAACATGTGACACTAACTCTTATTTTAATGGGAATATTTATGATAATTGGTATTATGTATGGTTTTATTAAATGTTACAAGAAATACCGAAAAATGGAAGATATTAAACCAGTTTTACCAAGTGGACTAGGAGTCCCCGAAAAGGATATTTCGAAATATGCTATTGGTGGTTGGAATCCTACAAACAAGGATGAGAAACCATCTTCAGACGAAATGTTGCTATTACCAAATAGTAGAACCACTGTATCTTCAGAATTGAAACAGAAAGAAAACAATAACAGTGCTTCTAGTGATCACACTGATAGTACAGCTTTATCAGATACATCACATGGGCCTGTAGAAAGACAAATCTCCTCATCTGATGATGGATCTAATTCATCACTACATCTTGAAGTAGAACCTACGAGAACAGCTGACAGTAACATCGATGGCGAATCATGCAATTCCGAAACTGAAACATCACAAATACCGTCACCATTCTTTAATGATAATACTTTCAAGAAAAATCCATGTGGCTATGTGCAACAATCTGTAGTGAGTCCTAATACAGGATATGTTCAAAGTGTTCAAGCAGGCGTTACAAACCCACCACAACCCTCATCACTCAGTGCCAGCTCTAGTTATGTAATGGCAGCTCTGTCTCCACCTATATTTACGACACGTGTTGCTCAACCTTGCGTAACGAGTTCACAATCAGCAGGAGGCTATGTGCACCCTGAAGGTGCTCAAACTATATCAGCAATGAATTTCCCGAAATTGGGGCAGACAACGAACAAACTGTTTGGTCCTGAAAGCTTGCCAACAATGCAAACCTTGCCACCAGCGAAACACACTGCAGACAGCAGCTACATTCAACTGCAATCTCTAGATTCCTTGCCCAGACACAAACATCCTGCCCGAAGTACAGTGCCATTAAAGACGCCAGCGTCTACCGGCTACGTCCGCCAAGGTGATCATAGGAAGCTTTATAGCGACTTGAGCACTGAAGAAGCCATCCTTCAGATTGCTGACACTATTGATAATCTCAATGGGATAGTGGAAGACGTGTTCTCTCGCTTAACGCGGCGAATCAAGCAGAATGTAGATAAAACCGCAAAATTGAATGAACGCATCGAAAACTCTAGGCTTAAAGTTGAAAAACTGACTGGAATGCAGAGAGCCATCAAAGTAATACAGGAGAAGCTACACTTCTATCATGTTAAAGTTGCGGAACCTAATTCACTCAAGCCCGATGAAGATTTTAGTTTGAACGCTGTTATTGATAACCTGGAAACCATCGGTGAACTTTTAGTATTTAACACCGATGAAAGCCCTTACTTCGGTGTTACCTCTAAAACACCAACCTACAAACCGGTCATCAAGAAATCGAATATTGAAAATAAGAGTCTAATAGAAGCGGCACCTTCGTCTATAATGAAGAAAGACGTCTTGAAGCGCGAAGTAGACGAATACATGTACGCACCTGGGATGGGAATGGTACCCGAAATGGAGATGCCGTTGGATTTACCGCATCTTCCAGGAATCGCTGAGGACATACAATATACTATCGCGACTGAAGGGTCTATAGCCCCGTCTGTCGTGACGTCACCGGTCACCGCCGATCATCGCCATTCCTGA
Protein
MKYEIRIYIKSKAAVKEEFWSDFTYTMVYTLSERPRRPPDTAVGAFDQSLYQTNRMIYIYWKQLEEYEEAGRMNFIVLSANKTMQVIELPRENRYQFAISANNGTKTSGMVWAICDISKDAIPMYGFPVKMDHGIPGKTFVKIKWAMTCTLQEGIITGYLIAYCPALDTTNVCATKNKTNLYISNPKQMEINITNLEPYTTYIFTLALNTTYGFKTVENAFTSMTTTEDTPTSPVNINITDVLSDSLTISWDPPIHKNGVIGKYVINNYGQEVYVEKVSDKDEDSKRRHIRLTGLQGFTNYSLSVQACSTAISSCSVLNPHDALFVRTRIGPPSKMRAPTVKNNPDFIKWVPPIIPGGTIDLYQIKRIKDESEAEIINTTNLSFSLIHCEGGVAGQTYQVRAVNFDEDPYHGALTDNKDVYLHNANYKGILEYPGEWSEPSFVNCTSKEHVTLTLILMGIFMIIGIMYGFIKCYKKYRKMEDIKPVLPSGLGVPEKDISKYAIGGWNPTNKDEKPSSDEMLLLPNSRTTVSSELKQKENNNSASSDHTDSTALSDTSHGPVERQISSSDDGSNSSLHLEVEPTRTADSNIDGESCNSETETSQIPSPFFNDNTFKKNPCGYVQQSVVSPNTGYVQSVQAGVTNPPQPSSLSASSSYVMAALSPPIFTTRVAQPCVTSSQSAGGYVHPEGAQTISAMNFPKLGQTTNKLFGPESLPTMQTLPPAKHTADSSYIQLQSLDSLPRHKHPARSTVPLKTPASTGYVRQGDHRKLYSDLSTEEAILQIADTIDNLNGIVEDVFSRLTRRIKQNVDKTAKLNERIENSRLKVEKLTGMQRAIKVIQEKLHFYHVKVAEPNSLKPDEDFSLNAVIDNLETIGELLVFNTDESPYFGVTSKTPTYKPVIKKSNIENKSLIEAAPSSIMKKDVLKREVDEYMYAPGMGMVPEMEMPLDLPHLPGIAEDIQYTIATEGSIAPSVVTSPVTADHRHS

Summary

Pfam
PF00041   fn3
Interpro
IPR036116   FN3_sf        + More
IPR003961   FN3_dom       
IPR013783   Ig-like_fold       
SUPFAM
SSF49265   SSF49265       
Gene 3D
PDB
6IAA     E-value=0.00850776,     Score=96

Ontologies

Topology

Length:
986
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
21.51931
Exp number, first 60 AAs:
0.00057
Total prob of N-in:
0.55321
inside
1  -  450
TMhelix
451  -  470
outside
471  -  986
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号