SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16757
Pre Gene Modal
BGIBMGA000932
Annotation
PREDICTED:_serine/threonine-protein_phosphatase_rdgC_[Bombyx_mori]
Full name
Serine/threonine-protein phosphatase with EF-hands       + More
Serine/threonine-protein phosphatase      
Serine/threonine-protein phosphatase rdgC      
Alternative Name
Retinal degeneration C protein
Location in the cell
Cytoplasmic   Reliability : 1.399 Mitochondrial   Reliability : 1.289 Nuclear   Reliability : 1.262
 

Sequence

CDS
ATGCGATATAAAGAGATTTACGTGTCGCTTCTGCGGCCGCCGGTGATCGAGGGCTCAACGGCCGCGGAGTCGATAGATAAGGTGGAGTGGAAGCAGGTGTTTGATATACTGTGGTCGGATCCACAATGCATCGGAGGATGTGTGGCAAATGCGCTTCGAGGAGCAGGAACCTACTTCGGCCCTGATGTAACAGCGTCGTCGTTCCTCCAGAAGAATAAGCTGAGCTTCATAATTAGAAGTCACGAGTGCAAGCCCGGTGGATACGAAATCATGCATGGCGGTAATGTAATTACAATTTTCTCGGCGTCGAACTATTACGAGTTGGGTTCCAACAAGGGCGCTTACCTGAAACTATGCGGGAACTCGTTGGAGCGCCAGTTCGTGCAATACACGGCGGCCGTGTCTCGCACGCGGCGTCTCACCTTCAGGCAGCGGGTTGGCCTTGTCGAATCGTCCGCCATGAGGGAGCTACACAATCAGATTATGATGGCCAGGAGATCTCTGGAAGCTACTTTCCGTAGCTTGGACTCGGAGCAAAGTGGTTTCATATCTATAAGCGATTGGTGTCAAGCCATGGAGGAGACAACACACCTCGGTCTCCCGTGGAGGATGCTTAAAGACAAGCTTGTTCGCACAGATCCCGAGACACGCAAAGTACGTTACATGGATACATTCGAACTCAACACCAATAGGAACGGACGAAAATCTGACACGCTGACAGTCGTCGAGACTTTGTATAAAAATCAAAGAAGCTTGGAGGCGATCTTCAAGATATTGGATAAAGATAATTCTGGTTACATAACGTTGGAAGAATTTTCCGAGGCTTGCCAGCTGATCGGCAAGTACATGCCGAATCCGATGACGCAGGAGCAGCTCGTCGACATCTGTCGGCTCATGGACATCAACAAGGACGGCCTGGTTGATCTCAACGAGTTCCTCGAGAGTTTCCGTCTCGCCGAAAAGAGTTTACACGAGCAGGAAAGGATGTACGAAGACATGCAGGCTACCTGA
Protein
MRYKEIYVSLLRPPVIEGSTAAESIDKVEWKQVFDILWSDPQCIGGCVANALRGAGTYFGPDVTASSFLQKNKLSFIIRSHECKPGGYEIMHGGNVITIFSASNYYELGSNKGAYLKLCGNSLERQFVQYTAAVSRTRRLTFRQRVGLVESSAMRELHNQIMMARRSLEATFRSLDSEQSGFISISDWCQAMEETTHLGLPWRMLKDKLVRTDPETRKVRYMDTFELNTNRNGRKSDTLTVVETLYKNQRSLEAIFKILDKDNSGYITLEEFSEACQLIGKYMPNPMTQEQLVDICRLMDINKDGLVDLNEFLESFRLAEKSLHEQERMYEDMQAT

Summary

Description
Phosphatase required to prevent light-induced retinal degeneration.
Catalytic Activity
H2O + O-phospho-L-threonyl-[protein] = L-threonyl-[protein] + phosphate
H2O + O-phospho-L-seryl-[protein] = L-seryl-[protein] + phosphate
Cofactor
Mn(2+)
Similarity
Belongs to the PPP phosphatase family.
Keywords
Calcium   Complete proteome   Hydrolase   Magnesium   Manganese   Metal-binding   Protein phosphatase   Reference proteome   Repeat   Sensory transduction   Vision  
Feature
chain  Serine/threonine-protein phosphatase
EC Number
3.1.3.16
EMBL
BABH01000935    KQ460205    KPJ16901.1    KQ459606    KPI91275.1    RSAL01000047    + More
RVE50532.1    AGBW02011268    OWR46920.1    ODYU01002624    SOQ40363.1    NWSH01000662    PCG74944.1    JTDY01003056    KOB70236.1    LJIG01022522    KRT80131.1    KQ971338    EFA01582.2    GECU01030324    JAS77382.1    GEBQ01013744    JAT26233.1    APGK01009376    APGK01009377    KB737932    ENN82832.1    AAAB01008966    EAA12933.4    GFTR01006749    JAW09677.1    CH477268    EAT45428.1    KB632337    ERL92855.1    KK852756    KDR17087.1    DS235760    EEB16582.1    APCN01001959    APCN01001960    ATLV01023923    KE525347    KFB49928.1    GEDC01009827    JAS27471.1    ADMH02000929    ETN64645.1    GEDC01030006    JAS07292.1    UFQS01000791    UFQT01000791    SSX06909.1    SSX27253.1    GBHO01023525    GBHO01023524    GDHC01015922    JAG20079.1    JAG20080.1    JAQ02707.1    AJWK01032810    AJWK01032811    JRES01001542    KNC22133.1    ACPB03022158    ACPB03022159    APGK01023024    KB740457    ENN80624.1    CM000363    EDX11204.1    AXCM01005116    CM002912    KMZ00726.1    CH954178    EDV52482.1    M89628    AE014296    BT015959    CM000159    KRK02292.1    CH480826    EDW44181.1    KQS44298.1    KMZ00727.1    KRK02291.1    UFQS01001279    UFQT01001279    SSX10107.1    SSX29829.1    KMZ00725.1    KQS44297.1    EDW95211.1    JXUM01007767    JXUM01007768    JXUM01007769    JXUM01007770    JXUM01007771    JXUM01007772    KQ560247    KXJ83583.1    CH902618    EDV39462.1    KPU78057.1    GAMC01016156    GAMC01016155    JAB90400.1    KPU78056.1    CH963847    EDW72874.2    GAKP01007729    JAC51223.1    OUUW01000009    SPP84721.1    CH379069    KRT07669.1    KRT07673.1    KRT07672.1    SPP84720.1    KRT07671.1    EDY73443.1    CH479188    EDW40193.1    CH940647    EDW70401.1    KRF84894.1    LJIJ01001427    ODM91769.1    CCAG010000237    CP012525    ALC44362.1    CH933809    EDW19411.1    KRG06631.1    CH916366    EDV96600.1    CCAG010004851    KRG06630.1    LNIX01000006    OXA52533.1    IACF01003719    LAB69330.1    GEFH01001259    JAP67322.1    GFPF01011705    MAA22851.1    GEDV01005900    JAP82657.1    GFAA01002374    JAU01061.1    JXJN01007898    JXJN01007899    GFWV01003041    MAA27771.1    GEGO01002314    JAR93090.1   
Pfam
PF13499   EF-hand_7        + More
PF00612   IQ
PF00149   Metallophos
PF13202   EF-hand_5
PF13833   EF-hand_8
PF08321   PPP5
Interpro
IPR002048   EF_hand_dom        + More
IPR011992   EF-hand-dom_pair       
IPR029052   Metallo-depent_PP-like       
IPR012008   Ser/Thr-Pase_EF-hand_contain       
IPR006186   Ser/Thr-sp_prot-phosphatase       
IPR018247   EF_Hand_1_Ca_BS       
IPR000048   IQ_motif_EF-hand-BS       
IPR004843   Calcineurin-like_PHP_ApaH       
IPR013235   PPP_dom       
IPR041767   MPP_RdgC       
SUPFAM
SSF47473   SSF47473       
Gene 3D
PDB
3H69     E-value=4.56791e-21,     Score=249

Ontologies

Topology

Length:
336
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0167
Exp number, first 60 AAs:
0.0024
Total prob of N-in:
0.03933
outside
1  -  336
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号