SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16747
Pre Gene Modal
BGIBMGA005944
Annotation
Serine/threonine-protein_phosphatase_1_regulatory_subunit_10?_partial_[Papilio_xuthus]
Location in the cell
Nuclear   Reliability : 2.98
 

Sequence

CDS
ATGGACGTTTCTGGGCCGCATACATTAACAGTTAATGGATTAAAAGGGGTTTTATGTTATCATAGAAAAAAAGGTCCCAAAAAGAACATTAAATGGAAACCTGACAGTGAACTAGAAACAATTCATGTATTTGACCTGGATGAGACTGAAAGAATAAATGTCACCAAAACATTCACGGATATGAAATATTTAGAAAGAATACACGAAAGGGAAGCTTTCGAAAAAGCAAGAAACCTTAGTAATGACGACGTTATGGAAGAACGTACAAATTGGAAGCCTTTGATTTTAGTAGATTTAGAAGGACAATTACAAGTAGATTATGGCAAAAACAGTAAAGAGAAAGATATACAGGCACTACGACAAAAAGTAACCTTACAACCTTTATATTTCAACAAGGCAATGATTCCTGATTCCCCAATTGAACCAGAATTAGAAACTCACACCTATTCTGAACCCTCAATAATTCCCTTGGAAGATGTCACTGGAAATCAAGATAATATAAGTGATTTTAGAAATATGCCTTGGCCTGAACCGAGAGGTAATGCTCCACCCCAAACACCGAGTAATATGACTGTTGGTGCTAGTCCATTATTCCCTAACAATCTCACACAATTTTCAAACACTTTTCCTAATACGCAATTTCCTGGAGTACCACCTGCCTTCCAAGGCCCTAACATCGTTCCTGGTGAGTGGCAAAATGGAATACCCCAACAGATGATACCAAATGGAATGCCTGGTCCAATAGGAACCCACAATTTAGCACCAGGTGTGATGCCTCCCGGAAGCCATCCACAAGGTATGATGATTTCACCTGAGACTATGATGATGGCTCCGGAGATGTTCGGAAACCCAACTCCAATGATTCCTGTACCACCGGAAAGTTTCAATATGCAACAGAATATGTATCCGATGGATTTCAACATGGTAGGTCCTCCGGGACCGGGCCCCGAAGGTTTTAATGGCCCTGGCCCTGGTTCTGGTCCCGGACCTGGTAATTTTAGAGGAGCCATGCGTGGTCGCGGTGTCAATGGTCATTGGCGCGGAAAGGGTGCGGGGAACTGGGAAAATCCGTCCAGGGGTGGTAGAGGAGGAGGCCCTCGCGGGAACCGAAAGACAATTTGTATGTATTTTCAAAGGAAGGGATCTTGTCGGCAGGGCGATAATTGTACATTCTTGCATCCAGGTGTGAACTGTCCTTTTTAA
Protein
MDVSGPHTLTVNGLKGVLCYHRKKGPKKNIKWKPDSELETIHVFDLDETERINVTKTFTDMKYLERIHEREAFEKARNLSNDDVMEERTNWKPLILVDLEGQLQVDYGKNSKEKDIQALRQKVTLQPLYFNKAMIPDSPIEPELETHTYSEPSIIPLEDVTGNQDNISDFRNMPWPEPRGNAPPQTPSNMTVGASPLFPNNLTQFSNTFPNTQFPGVPPAFQGPNIVPGEWQNGIPQQMIPNGMPGPIGTHNLAPGVMPPGSHPQGMMISPETMMMAPEMFGNPTPMIPVPPESFNMQQNMYPMDFNMVGPPGPGPEGFNGPGPGSGPGPGNFRGAMRGRGVNGHWRGKGAGNWENPSRGGRGGGPRGNRKTICMYFQRKGSCRQGDNCTFLHPGVNCPF

Summary

Pfam
PF18044   zf-CCCH_4        + More
PF08711   Med26
PF00642   zf-CCCH
Interpro
IPR017923   TFIIS_N        + More
IPR041367   Znf-CCCH_4       
IPR036855   Znf_CCCH_sf       
IPR000571   Znf_CCCH       
IPR035441   TFIIS/LEDGF_dom_sf       
IPR003617   TFIIS/CRSP70_N_sub       
SUPFAM
SSF90229   SSF90229        + More
SSF47676   SSF47676       
Gene 3D

Ontologies

Topology

Subcellular location
Nucleus  
Length:
400
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000950000000000001
Exp number, first 60 AAs:
0.00072
Total prob of N-in:
0.00363
outside
1  -  400
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号