SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16739
Pre Gene Modal
BGIBMGA014468
Annotation
non-LTR_retrotransposon_CATS_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 2.367
 

Sequence

CDS
ATGCCACATGCAGGCCTACGCAGACGATGTGGAGATCAAGCTCCTCGGAATAATTTTGGACGAAAAGCTGCTCTTTGGCCGCCATGTACAGTACGTCCTGGGAAAAGCCTCGCGAATATTCAACAAACTGTGCTTGTACTCCCGACCAACCTGGGTGCTCATCCCGAGAACGTGCGCACCATCTATCTCCGAGTCATCGAGCCAATCGTCACCTACGCTGCCGGGGTGTGGGGACACATAGTAAACAAGCGCTACATCAAAAAATCTTTGATGAGCATGCAGCGTGGTTTTGCCCTAAAAGCCATCAGAGGATTCCGCACTATTTCAACCTCCGCTGCTCTGGCTCTCGCACAATTCACCCCTCTAGACCTAAAAATCCGAGAAGTACACCAAATCGAAAAAGTCAGGCTCACTGGGAAAACTGAATTCCTTCCCAATGACATTTCTTATGAGAAACCTGTCCCCGTCAAGGACCTCCTACATCCCGCTAGAAGGCCGACTATCAAACCCATACCCTCCTCTGAACACCGAATTAACTCCGAAATGACGGACAGTACTCTGGTCACTCGCGTATTCACTGACGGAAGTAAGCAGGACGATGGATCAGTTGGAGCCGCATTCGTGCTTTACAGACCCGGCGACACTGAAACATCCGTAACAAAAAAGTACAAATTACACAGTAGCTGCACAGTCTTCCAGGCAGAGCTGTACGCCATCTGGAAAGCCTATTGGGTAAAGGGACACTCGGGTGTCATAGGAAACGAGGAAGCCGATGCGGCTGCCAACAGCGGCGCACGCATGCACAAGGCCCCCGACTACTCGCAGTTCTCAATATCCTACGTGAAACACAAGATTCGCACAGAACACCACGCCATCTGGCAAGCCAGATACGAAAGCTCCCCGCAGGGCTCACACACAAAAACACTACTACCAAAACTGAACGACATCAAAGAACTTAACAAATGCACACAAACAAACTTTCAGCATACACAAATACTCACAGGCCATGGATATCACAAGACATACTTACATCGCTTCAAAATAGCACCAGATGACACCTGCCCCTGCGACGGCACCTCCAGCCAAACTGTAGAACACCTCCTTAAAAACTGCCAAGCGTTCGCTGCGAAAAGGCACAGTCACGAAGAAACGTGCCACGCAGTACAGGTGCCACCATATAATTTACCTGAAATGTTAAAAAAGAAAGCTGCAATCAACTCTTTCACCTCGTTTTGCCAAACAATAATCAACAACATCAAGAAAATAAATGAAAACAATTAG
Protein
MPHAGLRRRCGDQAPRNNFGRKAALWPPCTVRPGKSLANIQQTVLVLPTNLGAHPENVRTIYLRVIEPIVTYAAGVWGHIVNKRYIKKSLMSMQRGFALKAIRGFRTISTSAALALAQFTPLDLKIREVHQIEKVRLTGKTEFLPNDISYEKPVPVKDLLHPARRPTIKPIPSSEHRINSEMTDSTLVTRVFTDGSKQDDGSVGAAFVLYRPGDTETSVTKKYKLHSSCTVFQAELYAIWKAYWVKGHSGVIGNEEADAAANSGARMHKAPDYSQFSISYVKHKIRTEHHAIWQARYESSPQGSHTKTLLPKLNDIKELNKCTQTNFQHTQILTGHGYHKTYLHRFKIAPDDTCPCDGTSSQTVEHLLKNCQAFAAKRHSHEETCHAVQVPPYNLPEMLKKKAAINSFTSFCQTIINNIKKINENN

Summary

Pfam
PF00078   RVT_1        + More
PF00075   RNase_H
PF14529   Exo_endo_phos_2
PF00270   DEAD
PF16012   DUF4780
Interpro
IPR012337   RNaseH-like_sf        + More
IPR000477   RT_dom       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR027417   P-loop_NTPase       
IPR014001   Helicase_ATP-bd       
IPR011545   DEAD/DEAH_box_helicase_dom       
IPR031961   DUF4780       
SUPFAM
SSF53098   SSF53098        + More
SSF56219   SSF56219       
SSF52540   SSF52540       
Gene 3D

Ontologies

Topology

Length:
426
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
4.21192
Exp number, first 60 AAs:
0.07301
Total prob of N-in:
0.14382
outside
1  -  426
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号