SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16736
Annotation
PREDICTED:_uncharacterized_protein_LOC101747094_isoform_X4_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.488
 

Sequence

CDS
ATGCAGCGTGATTGTCGTGTATTGGAGAGCTTCAAGATCATGGACTACTCCCTCCTGGTCGGCATACATAACTTAGATGACGCCCAGCGCGAGAAGAACGAAGCCAGGAAACTGACGGAATCCGGTCAGAGCGATGGTGAGGATAACGAAGGGGAGACCAAGAGAACTGGACTCAATCGAACGAGATCGATAAACCGACAGCGTCTGGTCGCGCACTCGACAGCCATGGAGAGCATACAGGCGGAAAGCGAGCCCATAGATGAGGAGGAAGATGTCCCGTCCGGCGGCATCCCGGCCCGGAACGCGCGTGGCGAGCGTCTGCTGCTGTTCCTGGGCATCATCGACATACTCCAGTCGTATCGTCTCCGGAAGAAGCTCGAGCACACTTGGAAGAGCATGATACACGATGGCGACACTGTATCGGTCCACAGACCCAGCTTCTACGCTCAGAGATTCTTAGATTTCATGGCTAAAACCGTTTTCAAGAAGATACCTTCGTATCCAGAGACATGA
Protein
MQRDCRVLESFKIMDYSLLVGIHNLDDAQREKNEARKLTESGQSDGEDNEGETKRTGLNRTRSINRQRLVAHSTAMESIQAESEPIDEEEDVPSGGIPARNARGERLLLFLGIIDILQSYRLRKKLEHTWKSMIHDGDTVSVHRPSFYAQRFLDFMAKTVFKKIPSYPET

Summary

EMBL
NWSH01001293    PCG71816.1    ODYU01001460    SOQ37685.1    RSAL01000127    RVE46519.1    + More
KQ460890    KPJ11008.1    GECU01032498    JAS75208.1    PYGN01000163    PSN52385.1    GL436229    EFN72215.1    GECU01033960    JAS73746.1    GECU01007856    JAS99850.1    GECU01017421    JAS90285.1    CH478832    EAT32594.1    GECU01023736    JAS83970.1    KQ978642    KYN29517.1    KQ982562    KYQ54831.1    GAPW01001171    JAC12427.1    GBYB01010572    JAG80339.1    AXCM01001968    CH477649    EAT37821.1    GEHC01000741    JAV46904.1    KQ981993    KYN31003.1    GBYB01010570    JAG80337.1    GFDL01016150    JAV18895.1    GFDL01009417    JAV25628.1    GGFM01003531    MBW24282.1    DS231957    EDS29006.1    KQ434899    KZC10869.1    ADTU01024787    ADTU01024788    KQ976881    KYN07602.1    KQ976543    KYM81004.1    KK853162    KDR10437.1    GL887655    EGI70484.1    GGFK01007395    MBW40716.1    NEVH01017587    PNF23753.1    PNF23750.1    PNF23751.1    PNF23748.1    PNF23752.1    GEBQ01015681    JAT24296.1    PNF23746.1    GEBQ01024748    JAT15229.1    AAZX01001175    GEBQ01026969    JAT13008.1    KK107874    EZA47349.1    KZ288247    PBC31176.1    GEBQ01029952    JAT10025.1    GGFK01007450    MBW40771.1    GECZ01026895    JAS42874.1    GGFJ01002584    MBW51725.1    GGFL01001481    MBW65659.1    GGFM01002200    MBW22951.1    KQ791045    OAD47036.1    GL448322    EFN84793.1    GGFL01000975    MBW65153.1    GGFL01001170    MBW65348.1    GEZM01019595    JAV89601.1    GGFK01005846    MBW39167.1    GGFK01005963    MBW39284.1    AAAB01008984    GANO01003279    JAB56592.1    ADMH02001355    ETN62891.1    APCN01003786    KQ414617    KOC68367.1    GEDC01027902    JAS09396.1    GEDC01019396    JAS17902.1    GEDC01023417    JAS13881.1    GEDC01003899    JAS33399.1    QOIP01000010    RLU17516.1    APGK01019954    KB740150    KB632173    ENN81251.1    ERL89576.1    KQ971351    KYB26781.1    KYB26780.1    KYB26783.1    QCYY01003988    ROT61799.1    GFTR01006165    JAW10261.1    CVRI01000054    CRL00174.1    CRL00175.1    DS235033    EEB10776.1    GBBK01002522    JAC21960.1    GDIQ01154003    JAK97722.1    LJIJ01000121    ODN02191.1    KK854080    PUA16071.1    GDIP01142679    JAL61035.1    GDIP01133826    JAL69888.1    GDIP01163818    JAJ59584.1    GFPF01005461    MAA16607.1    GDKW01003558    JAI53037.1    GDIQ01061303    JAN33434.1    UFQT01000988    SSX28305.1    UFQT01001338    SSX28306.1    SSX30100.1   
Pfam
PF01504   PIP5K
Interpro
IPR023610   PInositol-4-P-5-kinase        + More
IPR027483   PInositol-4-P-5-kinase_C       
IPR002498   PInositol-4-P-5-kinase_core       
IPR027484   PInositol-4-P-5-kinase_N       
Gene 3D
PDB
5E3U     E-value=6.60194e-41,     Score=416

Ontologies

Topology

Length:
170
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04964
Exp number, first 60 AAs:
0.00492
Total prob of N-in:
0.25441
outside
1  -  170
 
 

Population Genetic Test Statistics

Pi
2.469641
Theta
27.36464
Tajima's D
-1.194868
CLR
0.081412
CSRT
0.102694865256737
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号