SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16735
Pre Gene Modal
BGIBMGA009767
Annotation
PREDICTED:_uncharacterized_protein_LOC101747094_isoform_X3_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.474
 

Sequence

CDS
ATGAGCGATTTTACCGATACGACCATATCGACGTGGAACCAGCGTCACCCGCCCGCGCCCGCCGAATACCCCTCGGTCCTTTCCGACAGACTGAAAATACTAGACAGGGACAGAATCAATAACTACCAGAGGCGTATCGATTTCGACACCTCGAACTTGACGGCGCGCGATCCGGGACCCTCGTCGGCATTTTACGCCGACAACGCGTACCGGTCCAACGTTCAGGAACGGATGGAGACGCTCTCGGAACAGCTGACGAAGGTTTTGAGCACCGGGGCCGGGAGCTCACACATAAATGGTAGCTTAGCCGACAGCGGCATACAGACGGACAACACCAGCACCAGCGTGCCCCAGATATACGTATCGGAGGCGAACGTCGGACCACCGTTGAAGGAGCTCAGAGACGCGGCCGTCGATACCCGAAACGAGAACAATCTCCAGGACATACCGTTCATAGACGACGACGACGACGTCCGGTGGAAACGCAGGGCCAACATTGAGAAGCACAAGAGCATGTCCAACATACCGGAACGCGTCGAGGAGACAGCTAAGGAGCTCGCCGAAGAACGCCTCACGAACAGCCTCAATCGAGCGAAATCGCCAACGTTCGTCGAGAAATTCAAGAAATTCTTCGCCGATATAGGCCTCGTCAAACCAGAGGTCGAGAACACGGAAAGAGACGCCAACACTCTACCGAAGAGCCTCAATTCCAGTTACAGAACGAGAAGCGCGACCCCAACTTCGCTGGAGACCCGCGAAACGTCCACGCTGCCCAAGGATATGAGGTTCCGTAAGGTCAGGTCCACGCAGACGGTGTACATAAGGCAAGAGTCGCCGCTGCTGAGAGACAGGGAGGTCCAGACTCCGCCGCAGACTAAAGAGCAACACGTCTCCGTGGTGCAACTCAACGGAGACGAGCACGTAAAGTGTGAGGACTCTGAGAAGTTTCTAAAAGAAATCGTCTACATCAAGAGTATCGATAAAGCCGAGATATACACCGGCAAGGATAGCGGTAGTACAATTATCGTAATACCGCCTGCAGACTGA
Protein
MSDFTDTTISTWNQRHPPAPAEYPSVLSDRLKILDRDRINNYQRRIDFDTSNLTARDPGPSSAFYADNAYRSNVQERMETLSEQLTKVLSTGAGSSHINGSLADSGIQTDNTSTSVPQIYVSEANVGPPLKELRDAAVDTRNENNLQDIPFIDDDDDVRWKRRANIEKHKSMSNIPERVEETAKELAEERLTNSLNRAKSPTFVEKFKKFFADIGLVKPEVENTERDANTLPKSLNSSYRTRSATPTSLETRETSTLPKDMRFRKVRSTQTVYIRQESPLLRDREVQTPPQTKEQHVSVVQLNGDEHVKCEDSEKFLKEIVYIKSIDKAEIYTGKDSGSTIIVIPPAD

Summary

Pfam
PF01504   PIP5K
Interpro
IPR023610   PInositol-4-P-5-kinase        + More
IPR002498   PInositol-4-P-5-kinase_core       
IPR027484   PInositol-4-P-5-kinase_N       
IPR027483   PInositol-4-P-5-kinase_C       
Gene 3D

Ontologies

Topology

Length:
348
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01792
outside
1  -  348
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号