SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16715
Pre Gene Modal
BGIBMGA012706
Annotation
PREDICTED:_X-linked_retinitis_pigmentosa_GTPase_regulator-like_isoform_X1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.487
 

Sequence

CDS
ATGGATTTAGAAAAATCTCAATTTTTGTATGTTGATAATTTGTCGCACCGTGGTCAAACAGAGGATGGTCGCGTGTTTATGTGCGGCTCCAACTCCGAAGGGCAGCTCGGTTTAGGCGAAGACTCACGATCCGCTGTACGGTTCACTGAACTCAAGTTCATGGAGAAGATAGCCTTCATCGAATGCGGGTATTATCACACCGTCTTTATAACTACCAAAGGAGCAGTCTTTGTAACTGGCGACAACGAAAATCAGAAACTAGGTATCCAGAAAATAGCCACAAGCATCTACGTTCCGGAAGTTTTGCCCATAAGTACTCCAATAAAGAGCGCCTGCTGTGGGGCTGCACACACGTTCCTTCTGACAATGGATGAATCTAAAATATTGGGCTTCGGTTCCAATGAAAAGGGTCAGCTGGGAATGCCTCGAGAGGTCGAGTTTGTTACTGAGCCTAGCGAAATTGACATGGACATTATGTTCGACGGATACCAACTAAAGTTGGTCGCCTACAACGGACTACTGTACACGTGCGGCGAGTCGAGGCATAATAAACTGTGTTTGGAAGATATCGACGACACCAACTCAAACGAGGTGGTCCCCAATCAATACACCCCTAAACGGGTCACCGCCATGAATGGGCACATCGTAGACAATGTGGCGTGTGGGGGCTGCCACACTCTACTTACGGCCACCAAAGGCTCGAACGCGGACTTCACGAACAACGATTTCAACATTATTAACGAAGCCACCAGACAAATAACTCTCACCGAATTACCGCCCTTACAGAAAATACCAGCGATGAACAAAACCGAAGAGAATCCGTTCTTAATTGAAGACGTGACAAACTCTAACGTGGACGACAAACAGAAAGCGGATAACTTGAATGGAAACACGAACGAGGAATCCGGATCAATAGACTCGTTAGAGGCCAACGTGAGCGGATCACACATCGTAAACATAAACGACCTTGAAATTGAAAATGGAAGTACGCATGACCTGGCTGACCTAAACAAAGACAACATTGATCGTGTTTCCGACACAGGTGACTCGGCTATGGACGTGGTCGAAATTATGGACACGGTGCTTGACGATATGCAGACAAATGTTCATGATTCTGTAAAAGAGGTCACCGATACAGTCCATGAGAAAAAGGAAGTGATTGAAGAAGTAATTCACAAAACGGAAGCAAATGCAAAAGGGCTGCGCGATGATGTCACAAAGATTTTGACCGTTCCTGATAAAGTAGTCGAAATTGCAAATTCCCCGCTGCCTAAAACACCCATATTGCAAGAACTACTCCACGTTCCCGATATATCACAACTCAGTCCTGCTCACAGTAAGCACAGTGACGAGAAAAGTGAAACAGGCCAGTCCGAAAACGAAACAATAACATGCGCATCGGATAAATCTAGTCCTCAAGCTGGGAAGACAGCTAAAACACAAGCCGTTATGCCGATTGTCAGGAGCGAGGACCATATAGACTCTCATGTTGATGAAACCAATGAAGAATCAGATGTTGTTGTTAATAAATTGGAAGAGAAGGGTCGATTTGCGAGGATGTTTCAGTCAATACGAGACAAGGAAAACTCTTGTATGGGGAAGGGCAAAGTCATTGAGAGAAAGTTGTTGGTGAGTTATTAA
Protein
MDLEKSQFLYVDNLSHRGQTEDGRVFMCGSNSEGQLGLGEDSRSAVRFTELKFMEKIAFIECGYYHTVFITTKGAVFVTGDNENQKLGIQKIATSIYVPEVLPISTPIKSACCGAAHTFLLTMDESKILGFGSNEKGQLGMPREVEFVTEPSEIDMDIMFDGYQLKLVAYNGLLYTCGESRHNKLCLEDIDDTNSNEVVPNQYTPKRVTAMNGHIVDNVACGGCHTLLTATKGSNADFTNNDFNIINEATRQITLTELPPLQKIPAMNKTEENPFLIEDVTNSNVDDKQKADNLNGNTNEESGSIDSLEANVSGSHIVNINDLEIENGSTHDLADLNKDNIDRVSDTGDSAMDVVEIMDTVLDDMQTNVHDSVKEVTDTVHEKKEVIEEVIHKTEANAKGLRDDVTKILTVPDKVVEIANSPLPKTPILQELLHVPDISQLSPAHSKHSDEKSETGQSENETITCASDKSSPQAGKTAKTQAVMPIVRSEDHIDSHVDETNEESDVVVNKLEEKGRFARMFQSIRDKENSCMGKGKVIERKLLVSY

Summary

Pfam
PF00415   RCC1
Interpro
IPR009091   RCC1/BLIP-II        + More
IPR000408   Reg_chr_condens       
SUPFAM
SSF50985   SSF50985       
Gene 3D
PDB
4JHN     E-value=4.9573e-26,     Score=294

Ontologies

GO

Topology

Length:
546
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.23477
Exp number, first 60 AAs:
0.03515
Total prob of N-in:
0.01055
outside
1  -  546
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.080326
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号