SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16680
Pre Gene Modal
BGIBMGA014553
Annotation
hypothetical_protein_TcasGA2_TC034914?_partial_[Tribolium_castaneum]
Location in the cell
Cytoplasmic   Reliability : 1.522 Nuclear   Reliability : 2.07
 

Sequence

CDS
ATGTTCCATGATGCGACCAAACAGGACGGCCGAAGTCAAAAGGACATGTATGAGCTTCTGTCAGAATTAACCAAAATAGTGGAAGAGATGGGAAACAAAGAGCTGACGATTATAAAGCCCCAAGGAATCGATACAGGTGTAACAAGGAAGATGTTAGAAGTACTGTTCCGTGGAAAGGACATCAAACTAGAATTAAGGACACCTAAAAAAGGAGAAAATACAAACAATACGGAAACAAGAAAACGGGACGATGTAATAGTCATAGAAGGAGGGACAACTACTTATGCGGACACCGTAAAGAGGCTAAAAGAAGGAATAAAAGGGACCGCATCCCTAGAAAACATAAAAGGTGTAAAAAAGACTGCCAAGGGACAAGTACTGGTAAGAGTGATGGGAAATATTGAGGAGATGACTGGGAAAATAAGAGAAATGATGGGAGACAGAAAGGTAAGAAGAACTGGGGGGAGCAAGAAAAAAGTATTACACATAAAGGGAATGGACAGCTCGGTGGAAATGGAGGAAGTAAGGGAGGACTTAAAGTCGACAAACTTGATAAAAAAAGTAGACAGCTTGGAGATAAGATCACTGAGACCGATGGGCGGTGGAAACCAGACGGCAACAGTGATCCTGGATGAAGAGGATGCAGGAAGGCTGCTTGCGGGTGGGAAGATAAGAGTAGGGCTAAATATATGCCACATTCATGAAAGAATTGAACTGCTGAGATGCTACCGGTGCTGGGAATATGGCCACAAAGCGGAAAACTGCAACGTAAAAAAGGACACACAGCTGGCACCGGTAGATGCCCACTCTTCCGGGAGGCATTGGAAACCGCGAAGCGAAGTCAAACCTATAACAAAAATGGTTTTTAAAGTGTTACAGATAAATATGGACCGAGGGAAAGCCGCGCACGACCTACTTCTGGCAACTGCGAGCAAAATGAAAGCGGATCTCGTGATGCTAGCTGAACCCAATAGAAAGCTGGCAAAAGCTGCTGGATGGGAGTGCGACACCAGGGGAGATGCAGCCCTAGTGATTCTTAATAAAACACTGACGGTTTCTGAAATTTATAGGGGGAAGGGATTTGTTGGGTTCAAGATGAAGCACTTTGCCGCGTTCAGCTGTTACATATCTCCCAACTGCAGTTTTGAGGAGTTCAAAGCTGACGTCGATGAGCTTTGGACACTACTTAAAAAACAAAAGACACCGATCCTAGTGGCAGGAGATTTTAACTCTGCATCGAGAGCGTGGGGCAGTAAAGTAACCAACAAAAGGGGCCACTACCTGCTGGAAATGGTGGCGGACCTCGACACTGTCATCATGAATGAAGGCGTGACCCCAACTTTTGAAAGAGGAGACAGAACATCCAGGCCCGACATCACCATGGCCTCTGAAACGCTGGCAGGCAAGATCAGTAATTGGCAAGTGCTCGACGAGGAGACCATGAGCGGACATAAATATATAGCCTACGAGATAAAGCATGTATTGCCTCTATCCCAGTGCCATGCACAGATGAAAAGGTGGAACCTCCAAAGGCTGGACGTAGATAAGTTCACTAAAAGCATGAAAGGAGCGCAGATCTCGACTCCCATGGAACTGGTGCAGGCTACGACGGCAGCGTGTGACGCTTCTATGCCAAAGCAAAACAACCGCAAGAAGAAAGGAGTCTACTGGTGGAACAAGGAAATTGCGGAAGCAAGGAAGGAGTGTTTGAAATGCCGAAGGAGGTACACAAGGAATAACAAAAAGCTAGGAAAAGGGAAAGACAGGGAAAGTAACGAAGAAAATGAACACAAAAAGCAGTATAAGGAAGCGAAACTGGAGCTACAAAGACGAATATGGAAAGCGAAAGACGATAAATGGAGGGAAGTGTGCGAGGAAGTCGACAATGATATATGGGGACTGGGATACAAAATAGTGTCAAAAAAACTACGCGGAAACTCACCGATAAATATGGGCATGGCCCAAATTCAAAGCATAGCTGATGGCCTCTTCCCGGAACACATAGATTTCGAACGGAAAACGAAACCATCACAGGAGTTCCCAGAGGTGACCGAGGAGGAGATCATCCAACTAAAAGCTCGCATAAAGCTCAGGAAAGCCCCAGGGCCCGACCGGATTCCGCCGGAGATAGTGACTCTAGCAGTAGCAGTAATTCCAGACAGGATAAGGCTTGTGTTGCAGAAGGTGCTGGAGTCTGGCGTCTTCCCCAACAGCTGGAAAACAGCCAGACTAGTCCTGCTAAGAAAACCAGGCAAACCCGCTGAAGATCCTGCGGGGCACAGGCCGCTATGTCTACTGGACTGCTACGGAAAGCTGCTGGAGTCGCTGATCCTAGGCAGAATAGAAAAACAACTAGTGCAATCGGACTGTTTACAAGATTCACAGTACGGGTTCAGAAAGGGGAGGTCCACAGTGGATGCAGCCAACAAGCTACTTGAGATAGCGGAAGACGCGAGACGAGGAACCCACCGCACCAGAAGAATCTGCGCAGTAGTGGCCCTCGACGTCCGAAATGCTTTCAATTCTGCATCGTGGGAGCTCATCCTGGAGGAAATGGCTGCAATAGGTATGCCTCAATACATCTATAATATCATAAACAGCTACCTCCAGGACAGATGCATCATACTGACAGACGCCGAGGGAGGGGCTGTAGAGAAAAAGGTTACCGGTGGTGTTCCGCAGGGGTCGATACTGGGCCCCACGCTGTGGAACATACTCTATGATGGGGTACTGCGCCTCGAACTGGGGGACGGGGCAAAATTAATAGGCTTTGCTGACGATTTAGCTCTGGTGGTGTCAGCAAAGAAGGAAGCAGAACTGATGTCAATAACGAACGTAGCTCTAGAAAAGATCAGCGCTTGGATGAAGCAGAAGCGGCTACACTTGGCCCCAGAAAAGACCGAGGCAATTGTCTTAAGTGGGCGAAGGAAGCTGAGCGAGATCTGCTTTACCCTCCAGGGCGTCAGGGTGGTTCCAACCGACAAACTTAAATACCTTGGGTTGTGGTTTGACAAAAGTTTGAAGTTCGGTAAACACATTGAGGAAACAACGGGTAAAGCCGAAAGATTGACGGCCGCCCTTGGCCAAATTATGCCCAGAAAAGGAGGGCCGAGGTCAAGCAAGCGCAGACTACTGGCATCCGCGATACAATCTGTGATGTTATATGGAGCACCGGTGTGGGCAAGGGTAATGAATGTAGCGAAGTACAGGAACATGTATAGCAAAGTGCAACGACAGCTGGCAATACGCATCTGTGGAGCTTACCGTACTATATCGCTAGACGCCGTCTTGGTGATAGCGGGCCTGATACCGATAGAACGGCTAGCAAAGGAACGGCAACGCTACTACCACGAGGGGACAAGAACGAGAGAAGAGGAAAGAGCACATACAATAAAAGAATGGGAACGAGACTGGCAGAAGGAGGGAAAAGGTAAGTGGACTCGTACAATCATACCCAACCTTAGGCTCTGGATGGGACGGAAACATGGCGAAACCGACAGACTGCTGACACAGGCCCTAAGTGGGCATGGAGTTTTCAACACTTACCTGCATGCAATAGGGAAAGCAGAAAGCGCAAGTTGTCCATACTGCGAACATGTTGACACACCGGAACATGCCCTATTTCAATGCAAAAAGTTCTCAGAACTAAGAGAGAAAACGGAGGGAAGTGACGGAAAGGTGACTGTGGAAAACCTGATGGTGAGAATGATCCATAGTAAAGAAGAATGGGATAAATATGCGGGAATGCTCAAAGAGATAATGAGAGTGCGGGAAAAGGACGAAAGACTAAGGCAAGAATCTATCTATAATAATATATAA
Protein
MFHDATKQDGRSQKDMYELLSELTKIVEEMGNKELTIIKPQGIDTGVTRKMLEVLFRGKDIKLELRTPKKGENTNNTETRKRDDVIVIEGGTTTYADTVKRLKEGIKGTASLENIKGVKKTAKGQVLVRVMGNIEEMTGKIREMMGDRKVRRTGGSKKKVLHIKGMDSSVEMEEVREDLKSTNLIKKVDSLEIRSLRPMGGGNQTATVILDEEDAGRLLAGGKIRVGLNICHIHERIELLRCYRCWEYGHKAENCNVKKDTQLAPVDAHSSGRHWKPRSEVKPITKMVFKVLQINMDRGKAAHDLLLATASKMKADLVMLAEPNRKLAKAAGWECDTRGDAALVILNKTLTVSEIYRGKGFVGFKMKHFAAFSCYISPNCSFEEFKADVDELWTLLKKQKTPILVAGDFNSASRAWGSKVTNKRGHYLLEMVADLDTVIMNEGVTPTFERGDRTSRPDITMASETLAGKISNWQVLDEETMSGHKYIAYEIKHVLPLSQCHAQMKRWNLQRLDVDKFTKSMKGAQISTPMELVQATTAACDASMPKQNNRKKKGVYWWNKEIAEARKECLKCRRRYTRNNKKLGKGKDRESNEENEHKKQYKEAKLELQRRIWKAKDDKWREVCEEVDNDIWGLGYKIVSKKLRGNSPINMGMAQIQSIADGLFPEHIDFERKTKPSQEFPEVTEEEIIQLKARIKLRKAPGPDRIPPEIVTLAVAVIPDRIRLVLQKVLESGVFPNSWKTARLVLLRKPGKPAEDPAGHRPLCLLDCYGKLLESLILGRIEKQLVQSDCLQDSQYGFRKGRSTVDAANKLLEIAEDARRGTHRTRRICAVVALDVRNAFNSASWELILEEMAAIGMPQYIYNIINSYLQDRCIILTDAEGGAVEKKVTGGVPQGSILGPTLWNILYDGVLRLELGDGAKLIGFADDLALVVSAKKEAELMSITNVALEKISAWMKQKRLHLAPEKTEAIVLSGRRKLSEICFTLQGVRVVPTDKLKYLGLWFDKSLKFGKHIEETTGKAERLTAALGQIMPRKGGPRSSKRRLLASAIQSVMLYGAPVWARVMNVAKYRNMYSKVQRQLAIRICGAYRTISLDAVLVIAGLIPIERLAKERQRYYHEGTRTREEERAHTIKEWERDWQKEGKGKWTRTIIPNLRLWMGRKHGETDRLLTQALSGHGVFNTYLHAIGKAESASCPYCEHVDTPEHALFQCKKFSELREKTEGSDGKVTVENLMVRMIHSKEEWDKYAGMLKEIMRVREKDERLRQESIYNNI

Summary

EMBL
KQ971388    KYB24913.1    KQ971310    KYB29500.1    KYB29499.1    KQ972691    + More
KXZ75806.1    ABLF02041886    KQ972544    KXZ75869.1    KXZ75807.1    AB593325    BAK38646.1    KXZ75870.1    AB593321    BAK38639.1    AB593323    BAK38643.1    KQ971309    EEZ99146.1    GALX01005145    JAB63321.1    GFXV01003903    MBW15708.1    KQ972226    KYB24577.1    ABLF02013358    ABLF02013361    ABLF02054869    ABLF02011183    ABLF02041884    ABLF02018942    ABLF02041885    GALA01001777    JAA93075.1    GFTR01008427    JAW07999.1    GALA01001776    JAA93076.1    GALA01000302    JAA94550.1    KU543683    AMS38371.1    AB593326    BAK38647.1    GGFL01004044    MBW68222.1    ABLF02034925    ABLF02041557    GGFK01005660    MBW38981.1    GGMR01006838    MBY19457.1    KXZ75805.1    GAKP01002292    JAC56660.1    GGFJ01001369    MBW50510.1    GGFJ01001439    MBW50580.1    GGFJ01001454    MBW50595.1    GGFJ01001370    MBW50511.1    GGFJ01001453    MBW50594.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    KU543682    AMS38369.1    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    GFXV01002090    MBW13895.1    ABLF02018808    KU543679    AMS38363.1    AB593324    BAK38644.1    GDHF01029467    GDHF01011533    JAI22847.1    JAI40781.1    GGFL01004046    MBW68224.1    ABLF02007989    AB090815    BAC57906.1    GGFJ01001727    MBW50868.1    GGFL01004047    MBW68225.1    AB593327    BAK38648.1    ABLF02009073    ABLF02030702    ABLF02042963    GGMR01019493    MBY32112.1    GGFJ01001164    MBW50305.1    GGFJ01001165    MBW50306.1    GGFM01001554    MBW22305.1    ABLF02011238    AB593322    BAK38641.1    AB090814    BAC57904.1    ABLF02004854    ABLF02041317    GGFJ01001166    MBW50307.1    KQ971675    KYB24771.1    GGMR01015159    MBY27778.1    ABLF02018098    GGFK01007771    MBW41092.1    AB090817    BAC57910.1    KQ973256    KXZ75595.1    AJ278684    CAB99192.1    ABLF02027248    AB090812    BAC57900.1    GGFJ01001541    MBW50682.1    ABLF02030663    ABLF02041312    ABLF02014650    AB090813    BAC57902.1    M93690    AAA29363.1    GGFL01001192    MBW65370.1    ABLF02023257    AB090819    BAC57914.1    GGMR01012748    MBY25367.1    AB090821    BAC57918.1    AB090820    BAC57916.1    LBMM01006954    KMQ90166.1    AB090822    BAC57920.1    ABLF02021645    ABLF02020969    AB090823    BAC57922.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00098   zf-CCHC
PF00075   RNase_H
PF12017   Tnp_P_element
PF13966   zf-RVT
Interpro
IPR000477   RT_dom        + More
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000663   Natr_peptide       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
IPR021896   Transposase_37       
IPR026960   RVT-Znf       
IPR016067   S-AdoMet_deCO2ase_core       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
SSF53098   SSF53098       
SSF56276   SSF56276       
Gene 3D
PDB
1WDU     E-value=5.01964e-13,     Score=185

Ontologies

Topology

Length:
1272
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
21.15526
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1272
 
 

Population Genetic Test Statistics

Pi
3.484797
Theta
5.990565
Tajima's D
-1.590359
CLR
0.009334
CSRT
0.0450477476126194
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号