SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16668
Pre Gene Modal
BGIBMGA002210
Annotation
PREDICTED:_uncharacterized_protein_LOC101737771_isoform_X3_[Bombyx_mori]
Transcription factor
Location in the cell
Nuclear   Reliability : 3.103
 

Sequence

CDS
ATGCCTGATACTCATCGTACTTGTGAAGTTTGTGGTATCAAAGAAAGACATCTTACTGAAAAACGGTTTTTCGCAAGGTTTCCTCTGGATGTCAATAGATGTAAACAATGGGTAAAGATGGTTGGCAAAGAAGATCTGGCTTATCTTCAAGTACATATGCTACATGATTTAAAACATGTTTGTGAAGCACATTTCTCAAGACGAGACTTTACAAAATCAAAGAAGCGCTTAAAAAAACGAGCTGTACCCAAACTGAACTTGACACTGCCACCATTGAGAGATGAAATTCTTCTTCAATTTTTGCAACTCAACTCGCAAGCGGATGTCACCCCACAAGGCCAGTTCGAGGTTCAGGCCGTTCCTAGTGCTTTGATGCCAGCATCCTCAAGTCAGCCTAGCGGTCTAGAGAAAACTGATGTCACCCCACAAGGCCAGTTTGAGGTTCAGGCTGTTCCTTGTACTTCAATGCCAACATCCTCAAGTCAGTCTAGCAGTCTAGAGAAAAACGTCACCAAAGGAAGCCAGCGGAAAGAAAGTGAAAGTCAAATAAGAAAAAGAAAATTAGAAGATGTTGATGTTACACCACGGAAAAGGAAGCTCTTAAGTGAATTGAGAAAAACAAAGTGCACATTGGCATCATTAAAAAAGAGCGCGAAACTAATAGACAATTTATCGTCAGAGTTTCTAAAAGAAATTGTCACGTCTGCGTTGATAAATCAAAAGCGTAAGTCACAAGGCAAACGCTGGACTATTAAAAATAAAATATCAGCATTAGCCATCTTCAAGCGTTCACCAAAAGCTTACCGATATCTGCGATATCTCGCACCATTTCCGAGTATCAAAACATTGCAAAAATTAATGAAAAAAATACCTGTTGAGCCAGGTTTAAATACAGCTGTACTTGACCACCTGAAAAAACTAGCTCCCATTAAAAAAATAAGAGCAAAATTATGTTCGCTAGTCTTTGATGAAATAGCGTTAAAAGAAAGGTTAACTTATAGCGAAGCCACAGATAAAGTGGAAGGGTTTATCGATTATGGATATGAGAGGAAAGATGAGCTAGCAAATCATGCCTTAGTCTTCATGTTACAAGGTATTGGGAGAAAAATTAAACAACCGCTGGCATTCTATTTCATAAGAGGCACAGTATCTTCAGAAAAATTAGCAGTTTTAATAAAAGATATAATTAAAGAAATTACTAACTCGGGATTTCAAGTTTTATCAACAATATGTGATCAAGCGCCCACCAATATGGGAGCATTAAGTCTGTTAAAGGAGTGGAACAATGGTGGACATAATTATTTTGAATTTGAAAATAAAAAAATTTATATAATTTATGATATTCCACATTTATTAAAATCACTGAGAAATAACTTTTTAAAACAAGGATTTCTGAAAATGGGAGAATTGAAAGGTCAATGGAGCCATTTAGTTGAGGTAGAGGAACGAAATAGAAATTTTTTATATCTTAGCAAACTCAAATCAACTCATGTACAACCAAAGTACAGAGCTAAAATGAAAGTTAAGTATGCCGCACAAATATTTAGCCAAACAGTGGCTGCTGTTCTTAAATTATTAGCTACGAATGTGGAAAATGTACACCGATCAGATGAAATATTACAGACTGCTTTGTTAATTGAAAAATTCAATAAACTTTTTGATTATACAAATGGGCCATCAGGACATGCTGACGTAAAAAAAGGTATACGGGAAAACGTATCTGCTAAAACTGACCATTTAGCTGTTTGGACAGAATATAGAAAGCAACTGTCTACTTTAACATTTTTCAACCATAATGGCGTGGAAGCAAAAAATGTAAAGTGTGTTCAAGGCTACATTATATCATTAAAATCGCTGCGTGATATTTGGCTGGAAGTTCAGGATTTAGGATATAAGTATTTGAATCTACGGCAGTTAAACCAGGATGCATTAGAAAATTTATTTGGGTTAATAAGACAGCATGGTCAAACAAACAAGCATCCGACGTGTTCTACATTTATAGCAGCTATGAAAACCTCTATAATATCAGGACTTACCGCCCCTCACAGCAAAAACTCCAATTGTGAAGAAGACAAAAAGGAACTCATGACGGATTTTCATGATTTAGTTTTTGGGTTTAAAGACGAAGATGATCAAGGTCAAGATATTAATGAGTCTCCTAGTCATGTTTCCACAGAAAATGAAAATGAGGAAGACAACCCGGTTCTCAGTATACCTGAAGAAGAAGAATATAAAGAAATAATCACGAAGATGTCGTCACCGAGCGCTGGGAAACGACGCATGGACACCGATGTCATCAAACTTATCGAAAGCAAGCACGAAGTGACAATCCTGAGCGGCCTTAACGAGTTCTGCGTGAAATTCTTCGGACCTCCAGGAACGCCATACGAAGGTGGTGTGTGGAGAGTACGCGTGCACCTTCCCGATCATTACCCCTTCAAGTCTCCGTCCATCGGTTTCATGAATAAGGTCTACCACCCCAACATAGATGAGGTGTCGGGGACCGTGTGTCTTGACGTCATCAACCAGGCGTGGACTGCCCTTTATGACTTATCGAATATATTTGAATCGTTTCTGCCGCAACTGCTCACCTACCCGAACCGATCGACCGCTGAACGGTGA
Protein
MPDTHRTCEVCGIKERHLTEKRFFARFPLDVNRCKQWVKMVGKEDLAYLQVHMLHDLKHVCEAHFSRRDFTKSKKRLKKRAVPKLNLTLPPLRDEILLQFLQLNSQADVTPQGQFEVQAVPSALMPASSSQPSGLEKTDVTPQGQFEVQAVPCTSMPTSSSQSSSLEKNVTKGSQRKESESQIRKRKLEDVDVTPRKRKLLSELRKTKCTLASLKKSAKLIDNLSSEFLKEIVTSALINQKRKSQGKRWTIKNKISALAIFKRSPKAYRYLRYLAPFPSIKTLQKLMKKIPVEPGLNTAVLDHLKKLAPIKKIRAKLCSLVFDEIALKERLTYSEATDKVEGFIDYGYERKDELANHALVFMLQGIGRKIKQPLAFYFIRGTVSSEKLAVLIKDIIKEITNSGFQVLSTICDQAPTNMGALSLLKEWNNGGHNYFEFENKKIYIIYDIPHLLKSLRNNFLKQGFLKMGELKGQWSHLVEVEERNRNFLYLSKLKSTHVQPKYRAKMKVKYAAQIFSQTVAAVLKLLATNVENVHRSDEILQTALLIEKFNKLFDYTNGPSGHADVKKGIRENVSAKTDHLAVWTEYRKQLSTLTFFNHNGVEAKNVKCVQGYIISLKSLRDIWLEVQDLGYKYLNLRQLNQDALENLFGLIRQHGQTNKHPTCSTFIAAMKTSIISGLTAPHSKNSNCEEDKKELMTDFHDLVFGFKDEDDQGQDINESPSHVSTENENEEDNPVLSIPEEEEYKEIITKMSSPSAGKRRMDTDVIKLIESKHEVTILSGLNEFCVKFFGPPGTPYEGGVWRVRVHLPDHYPFKSPSIGFMNKVYHPNIDEVSGTVCLDVINQAWTALYDLSNIFESFLPQLLTYPNRSTAER

Summary

Pfam
PF05485   THAP        + More
PF12017   Tnp_P_element
PF14291   DUF4371
Interpro
IPR021896   Transposase_37        + More
IPR006612   THAP_Znf       
IPR038441   THAP_Znf_sf       
IPR025398   DUF4371       
Gene 3D
PDB
2Z5D     E-value=4.75976e-59,     Score=581

Ontologies

Topology

Length:
873
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00406
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00012
outside
1  -  873
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.08604
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号