SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16661
Pre Gene Modal
BGIBMGA007097
Annotation
PREDICTED:_uncharacterized_protein_LOC107191251_[Dufourea_novaeangliae]
Location in the cell
Nuclear   Reliability : 3.055
 

Sequence

CDS
ATGATGCATGTGATGCAGCAAATGTCGGAACGCTTAAGTACACCAGCAGAAACTAAGATACGTATAAATGATATTTACCTACCATCATTTGACCCCGATACTAGTGTGGGAGTACGTGAGTGGTGTCAACATATCGACAAAGCCATTGAGACTTATCGACTCAACGACTTTGACATACGCATGAAAGTTGGCAGCCTCCTAAAGGGAAGAGCGAAGATGTGGGTTGACGATTGGATGGTCACTGCAGCTTCGTGGGCTGAGCTGCGCAACAATCTTATCACGACATTCGAGCCAGAAAATCGCTATTCTCGAGACATAGCTCGATTTAGAGAACATATGTACGACTCTTCAAAGGACATCTCGGAGTTCTTGTCACGAGCTTGGGTCTTGTGGAGGAGGATCACCAAAGACAAACTACCTAATGAAGATGCAGTTGAAGCAGTTATTGGTTGCGTGAATGACGAGAAACTTAGGATCGAGCTACTGAACACAAGAGCCACAACAGTACCAGAATTGATATCTGTTGCATCATCAGTAAGAGCCATGAAGCGTTTTCACCAGGGCTCAAATAAGCTGAGTACAAATAAGCGTCCCCGTTTTTTGAATTCTACTTCATCAAATTCATCTTGCCATATCTGTAAAAGAACTAATCACACCACCAACGAATGCTACTACAAAATGGTTACCGAATCAAAGCCCGAACAAAGAAACAAAACAAAAACTGAGACAACGAAGGAAGTAACCTCCTACCAGAACGATAAAACAACAATCTGTTCATTCTGCAAAATACCAGGACACAGTTTTGAAACATGCTTCAAACGTGAACGAGCATTGACATCAAACGTAAATTACGTTGCTGGATCAAAACTAGCTCCGATTCAGGTGAAGTTTGGATCAAAGAGTTTTCAGGCAATCTTTGATAGTGGCGCAGAATGCTCACTTATGCGGGAATCCGTAGCAGCTCAAATACCCGGAAAAAGACTACAAACGGCAGATTACTTGAAAGGAATTGGACAATTTCCTGTACTATCAATAGCTACACTCGTAACGGTAGGTGTCATCGATAACATCAACGTTGAATTACAGTTTCACATAGTGGCAGATTACGAGATGACTACAGATATTTTAGTGGGTATGAACTTGATAAACAATACGAACCTAACTATGACGATCACTTCGGGCGGGACGAGGCTAGCACGTCAGCCACATGTTAATCAAGTTCAGTGTATAAATCCAATTTTCGATAAACTGGATTGTGATCTCACAAATGAAGAAGATATCGCAAAATTACGCACCCTTCTAAACAAATATCAGCACCTGTTTATCAGAGGGTATCCAACAACTCGTGTCAAGACAGGTGAACTGGAAATCCGCCTGAAGAATCCAAACAAATATGTAGAACGAAGACCTTACAGGCTCAGTCCAATCGAACGAGAAAGGGTGCGAGCCATTGTGAAAGAGTTGATGGAGCATGGCATTGTACGCGAAAGCAAGTCTCCATACTCCAGTCCCATCATCTTGGTGAAGAAGAAGAATGGTGACGATCGCATGTGCGTGGATTTCAGAGAACTTAACTCTAATACCTTACGGGACCATTACCCGCTGCCACTAATTTCAGACCAAATTGACCAATTGGCCAAGGGGCAATTCTTTACAACCTTTGACATGGCCGCAGGGTTTCACCAAATACCTATTGCAGAATCATCAATTGAAAAGACAGCCTTTGTCACACCGGATGGACTGTATGAATATACGACTATGCCATTTGGATTGAGTAATGCATGTTCAGTCTATCAACGATGCATCAACAGAGCTCTGAGCTCGTTAATAGGGAATGCAGCTCAAGTCTACGTCGATGACGTATTAAGCAGATGTGAAAATATCGCAGAAGGGCTGTCAAACATAGAACGTATTCTAATAGCACTACAAGATGCGGGTTTTTCCATTAATGCAGATAAATGCAGTTTTTTTAAGCGTTCAATCGAATATTTGGGTAACGTAGTATCTAATGGACAAGTCTGGCCAAGCCCACGGAAAATAGATGCTCTGGTAAAATCGCCGGTACCAACAACACCCAGACAAGTAAGACAATTTTGTGGATTGGCTGGCTACTTTAGAAAATTTATAGCAGACTTCTCACGCATAATGATACCACTATACGAGTTGACCAAATCAGGGGCTAAATGGGAGTGGGACGAGCGCCATGAGAAAGCAAGAGAGAATGTCATTCAGTGCTTAACATCAACTCCAGTACTTACACTATTCCAGGAGGAAGCACCTATTCAATTGTACACAGATGCAAGTAGTTTGGGATTCGGAGCAGTACTGGGTCAACAGCTTCAACACGCAGACTACTTCAGTAGGAACCCAGTCGAACTCACAGTGAATATAATGACCAGAGATCTAGACTGGCTGAAAATTGAACAGCGACGTGATGAAACACTACGAGCTATAATGGATGGTATGAATAATAACAATCCAAGTAACGGCTATATGCTAGAAAACAATGTCCTCAAGCATATCGTACAAGATCCAACCTTCGGACACCGATACTGCACAGTGGTGCCCAGGTCCTTTCAGTGGAGTTTAATAAACTCCTTCCACACCGCACTGAAGCACCCTGGCTGGGAAAAGACGTTGCAGAAAATTAAGGACAGCCACTGGTTTGACAACATGAGCACGAAGGTACGAAAATTTGTTGATAATTGCGTGGTCTGCAGGACATCGAAAGGAGCATCTGGTGCGGTACAAGCTCAAATGCACCCGATTCAGAAACCGTCTGCTGCTTTTCAAGTAATACACATGGATATAACAGGCAAGATGGGAACATCCAACGACCAACAGTATGTGATTATCACCATAGATGCTTTTACGAAATACGTGCTATTCTATTATGCAACTAACAAAAATCCACCCAGCACATTAGCTGCCTTAAAGCGTACGGTTCATCTATTCGGTACTCCTGTCCAAATAATAGTCGACGGTGGAAGAGAGTTCCTCGGTGAATTCAAGACCTACTGCGATAGGGTAGGTATTGACATTCATGCTATAGCACCAGGAGTCAGCCGAGCAAATGGACAAGTAGAACGCGTCGTAGCTACACTAAAAAATGCTCTTACTATGATCAAGAATTACGAAACAGAAGAGTGGCACACAACGATTGCAGAACTTCAGCTAGCAATAAATTGCACTCCGCATCGTGTGACAGGCGTAGCTCCACTTACATTACTCACTCAGCGAAAGCATTGTGTTCCTCCAGAGCTACTTAAATTAGTAAATATTGACGAGCAGACTATTGATATTGAAGCACTCACTAACCATGTTCAACACAAGATGTCACAAAATGCAGAACAGGACAGGCAACGTTTCAATTCAAAAAAAGCTAGGATCCATCATTTCCAGCGTGGTGATTATGTGCTCATAAAAAATAATACTCGTAATCAAACTTCGTTGGATCTCAAATTCAGCGAGCCATATGAGATAACAAGAATCCTGGACAACGACCGCTATTTAGTAAAAAAGGTGGTTGGTTCAGAGCGTTCAAGAAAAGTAGCTCATCATCAACTCCGTCGGGCACCGCAACCTGGAGACCAGATAGCCGTATCGGCGGAAGAAGACGACCCTCCAGCATCAGCCGATGAACCTATATGA
Protein
MMHVMQQMSERLSTPAETKIRINDIYLPSFDPDTSVGVREWCQHIDKAIETYRLNDFDIRMKVGSLLKGRAKMWVDDWMVTAASWAELRNNLITTFEPENRYSRDIARFREHMYDSSKDISEFLSRAWVLWRRITKDKLPNEDAVEAVIGCVNDEKLRIELLNTRATTVPELISVASSVRAMKRFHQGSNKLSTNKRPRFLNSTSSNSSCHICKRTNHTTNECYYKMVTESKPEQRNKTKTETTKEVTSYQNDKTTICSFCKIPGHSFETCFKRERALTSNVNYVAGSKLAPIQVKFGSKSFQAIFDSGAECSLMRESVAAQIPGKRLQTADYLKGIGQFPVLSIATLVTVGVIDNINVELQFHIVADYEMTTDILVGMNLINNTNLTMTITSGGTRLARQPHVNQVQCINPIFDKLDCDLTNEEDIAKLRTLLNKYQHLFIRGYPTTRVKTGELEIRLKNPNKYVERRPYRLSPIERERVRAIVKELMEHGIVRESKSPYSSPIILVKKKNGDDRMCVDFRELNSNTLRDHYPLPLISDQIDQLAKGQFFTTFDMAAGFHQIPIAESSIEKTAFVTPDGLYEYTTMPFGLSNACSVYQRCINRALSSLIGNAAQVYVDDVLSRCENIAEGLSNIERILIALQDAGFSINADKCSFFKRSIEYLGNVVSNGQVWPSPRKIDALVKSPVPTTPRQVRQFCGLAGYFRKFIADFSRIMIPLYELTKSGAKWEWDERHEKARENVIQCLTSTPVLTLFQEEAPIQLYTDASSLGFGAVLGQQLQHADYFSRNPVELTVNIMTRDLDWLKIEQRRDETLRAIMDGMNNNNPSNGYMLENNVLKHIVQDPTFGHRYCTVVPRSFQWSLINSFHTALKHPGWEKTLQKIKDSHWFDNMSTKVRKFVDNCVVCRTSKGASGAVQAQMHPIQKPSAAFQVIHMDITGKMGTSNDQQYVIITIDAFTKYVLFYYATNKNPPSTLAALKRTVHLFGTPVQIIVDGGREFLGEFKTYCDRVGIDIHAIAPGVSRANGQVERVVATLKNALTMIKNYETEEWHTTIAELQLAINCTPHRVTGVAPLTLLTQRKHCVPPELLKLVNIDEQTIDIEALTNHVQHKMSQNAEQDRQRFNSKKARIHHFQRGDYVLIKNNTRNQTSLDLKFSEPYEITRILDNDRYLVKKVVGSERSRKVAHHQLRRAPQPGDQIAVSAEEDDPPASADEPI

Summary

Pfam
PF00665   rve        + More
PF17917   RT_RNaseH
PF00078   RVT_1
PF00098   zf-CCHC
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF00077   RVP
Interpro
IPR036875   Znf_CCHC_sf        + More
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR000477   RT_dom       
IPR041373   RT_RNaseH       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR018061   Retropepsins       
SUPFAM
SSF57756   SSF57756        + More
SSF53098   SSF53098       
SSF50630   SSF50630       
Gene 3D
ProteinModelPortal
PDB
4OL8     E-value=2.88415e-55,     Score=549

Ontologies

Topology

Length:
1216
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10061
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00392
outside
1  -  1216
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号