SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16646
Pre Gene Modal
BGIBMGA014553
Annotation
hypothetical_protein_TcasGA2_TC034203_[Tribolium_castaneum]
Location in the cell
Nuclear   Reliability : 3.777
 

Sequence

CDS
ATGGAAGAGGAAGAACAGCCAGTTATCACCGCGTACTCCGGTGAAAACGACTACAGTGATCAAGGAAGTATAGGAGAGAGCTTTGAGGTTTCCAGTGTGACGATATTGGAGAAAGACTGGGAACAGGTGGAAGACCCGTTTAAAAGAAGGGAGTCAATCAAACGGACGCCCCCAGGGGCATTAAAAGAACTTAAGACACCCAGTAAAATGGCGGATAGCGGCACGCTAGTACAGGAAGATGTCTTTTTAACTCCTAAAGAAAAGATAGCTGAAGTAGCGGAAAATACACCAATGAGGCCAAAAAAGCGGAAAAAATTGTCCAGTCCGATAGTGATCCAACCCGTTGAAGCAGAGCCACCAGTGGAGTACCTGAAACTAAAAACTAAAATAGATAAGTTGGTAAAGTTTGGGAAAGAAAATAAAAATGTGCATCGGCAAATTAAGGACTTACTGATTGACCTCCCAGGACTGATGGAGCGGGTAACTATAAGATACAAGGACGATACAAATAAACCAACAGAAATGGAGCAAAAGTTTGAAGCTTACAAAAAGGAGCAAGAAGAAAAGATCAGGAGACTAGAACAGGAAATTAAGGAACTTAAGACACTGCATAAACGAGAGACTGGAGAGAACCAACTTTTCAAGCTTGACGATCAAATGATTGACAGCTATGACGACTTCTCGAAAGTTTCAAGCATGGACTGGACGCAGGATAGTTACAAAAGGACAAAGATAGGCCATGGAGACATCTTTCTGAGAACCACCGACTGTACAGTCTACTTCTGTGATGAGAGGGAGAAAGCACACTCGAGGCTGACAAGAAGGGTGCTAAGCCGATATCCAGAAGTGACTAAGAGCGAGAAAATGGCATGCGCAGGAGGAGCATACGACGGCCGAAGTCAAAAGGACATGTATGAGCTCCTGTCCGAATTAACCAAAATAGTGGAAGAGATGGGAAACAAAGAGCTGACTATTATAAAGCCCCAAGGAATCGATACAGGTGTAATAAGAAAGATGTTAGAAGTACTGTTCCGTGGAAAGGACATCGAATTAGAATTAAGGACACCTAAAAAAGGAGAAAACACAAACAATACGGAAACAAGAAAACGGGACGAGGTAATAGTCATAGAAGGAGGGACAACTACTTATGCGGACACCGTAAAGAGGCTAAAAGAAGGAATAAAAGGGACCGCATCCCTAGAAAACATAAAAGGTGTAAAAAAGACAGCCAAGGGACAAGTACTGGTAAGAGTGATGGGAAATATTGAGGAGATGACTGGGAAAATAAGAGAAATGATGCGAGATAGAAAGATAAATATAGACCGAGGGAAAGCCGCGCACGACCTACTTCTGGCAACTGCGAGCAGTATGAACGCGATCTTGGGGAAGGGATTTATTGGATTCAAAATGAAGGACTTTGCCGCGTTCAGCTGTTATATATCTCCAAACTGCAGTTTCGAGGAGTTCAAAGCAGACGTCGATGAGCTTTGGACACTACTTAAAAAACAAAAGACACCGATCCTAGTGGCAGGAGATTTTAACTCTGCATCGAGAGCGTGGGGCAGTAAAGCAACCAACAAAAGGGGCCACTACCTGCTGGAAATGGTGGCGGACCTTGACACTGTCATCATGAATGAAGGCGTGACCCCAACTTTTGAAAGAGGAGACAGAACATCTAGGCCCGACATCACCATGGCCTCTGAAACGCTGGCAGGCAAGATTAGTAATTGGCAAGTGCGCGACGAGGAGACAATGAGCGGACATAAATATATAGCCTACGAGATAAAGCATGTATTGCCTCTATCCCAGTGCCATGCACAGATGAAAAGGTGGAACCTCCAAAGGCTGGACGTAGATAAGTTCAGTAGAAGCCTGAAAGGAGCGCAGATCTCGACTCCCATGGAACTGGTGCAGGCTACGACGGCAGCGTGTGACGCTTCTATGCCAAAGCAAAACAACCGCAAGAAGAAAGGAGTCTACTGGTGGAACAAGGAAATTGCGGAAGCAAGGAAGGAGTGTTTGAAATGCCGAAGGAGGTACACAAGGAATAACAAAAAAGCTAGGAAAAGGGAAAGACAGGGAAACATAGCTGATGGCCTCTTCCCGGAACACATAGATTTCGAACGGAAAACGAAACCGTCACAGGAGTTCCCAGAGGTGACCGAGGAGGAGATCATCCAACTAAAAGCTCGCATAAAGCTCAGGAAAGCCCCAGGGCCCGATCGGATTCCGCCGGAGATAGTGACTCTAGCAGTAGCAGTAATTCCAGACAAGATAAGGCTTGTGTTGCAGAAGGTGCTGGAGTCTGGCGTCTTCCCCAACAGCTGGAAAACAGCCAGACTAGTCCTGCTAAAAAAAACCAGGCAAACCCGCTGA
Protein
MEEEEQPVITAYSGENDYSDQGSIGESFEVSSVTILEKDWEQVEDPFKRRESIKRTPPGALKELKTPSKMADSGTLVQEDVFLTPKEKIAEVAENTPMRPKKRKKLSSPIVIQPVEAEPPVEYLKLKTKIDKLVKFGKENKNVHRQIKDLLIDLPGLMERVTIRYKDDTNKPTEMEQKFEAYKKEQEEKIRRLEQEIKELKTLHKRETGENQLFKLDDQMIDSYDDFSKVSSMDWTQDSYKRTKIGHGDIFLRTTDCTVYFCDEREKAHSRLTRRVLSRYPEVTKSEKMACAGGAYDGRSQKDMYELLSELTKIVEEMGNKELTIIKPQGIDTGVIRKMLEVLFRGKDIELELRTPKKGENTNNTETRKRDEVIVIEGGTTTYADTVKRLKEGIKGTASLENIKGVKKTAKGQVLVRVMGNIEEMTGKIREMMRDRKINIDRGKAAHDLLLATASSMNAILGKGFIGFKMKDFAAFSCYISPNCSFEEFKADVDELWTLLKKQKTPILVAGDFNSASRAWGSKATNKRGHYLLEMVADLDTVIMNEGVTPTFERGDRTSRPDITMASETLAGKISNWQVRDEETMSGHKYIAYEIKHVLPLSQCHAQMKRWNLQRLDVDKFSRSLKGAQISTPMELVQATTAACDASMPKQNNRKKKGVYWWNKEIAEARKECLKCRRRYTRNNKKARKRERQGNIADGLFPEHIDFERKTKPSQEFPEVTEEEIIQLKARIKLRKAPGPDRIPPEIVTLAVAVIPDKIRLVLQKVLESGVFPNSWKTARLVLLKKTRQTR

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal
PDB
1WDU     E-value=6.37823e-08,     Score=139

Ontologies

GO

Topology

Length:
791
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03103
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00033
outside
1  -  791
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号