SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16645
Pre Gene Modal
BGIBMGA014553
Annotation
hypothetical_protein_TcasGA2_TC034914?_partial_[Tribolium_castaneum]
Location in the cell
Nuclear   Reliability : 2.841
 

Sequence

CDS
ATGCCGGCCGGAGGTGAACCGGTCCCTGATGTCCCGCCTGTCCGGAGGTCCTCCGTAGTCCACACCACCCTCAGGAAGCTGCCGAAGCTGGAGACTACTCAGGGAAGAGAAATGGAAGAGGAAGAACAGCCAGTTATCACCGCGTACTCCGGTGAAAACGACTACAGTGATCAAGGAAGTATAGGAGAGAGCTTTGAGGTTTCCAGTGTGACGATATTGGAGAAAGACTGGGAACAGGTGGAAGACCCGTTTAAAAGAAGGGAGTCAATCAAACGGACGCCCCCAGGGGCATTAAAAGAACTTAAGACACCCAGTAAAATGGCGGATAGCGGCACGCTAGTACAGGAAGATGTCTTTTTAACTCCTAAAGAAAAGATAGCTGAAGTAGCGGAAAATACACCAATGAGGCCAAAAAAGCGGAAAAAATTGTCCAGTCCGATAGTGATCCAACCCGTTGAAGCAGAGCCACCAGTGGAGTACCTGAAACTAAAAACTAAAATAGATAAGTTGGTAAAGTTTGGGAAAGAAAATAAAAATGTGCATCGGCAAATTAAGGACTTACTGATTGACCTCCCAGGACTGATGGAGCGGGTAACTATAAGATACAAGGACGATACAAATAAACCAACAGAAATGGAGCAAAAGTTTGAAGCTTACAAAAAGGAGCAAGAAGAAAAGATCAGGAGACTAGAACAGGAAATTAAGGAACTTAAGACACTGCATAAACGAGAGACTGGAGAGAACCAACTTTTCAAGCTTGACGATCAAATGATTGACAGCTATGACGACTTCTCGAAAGTTTCAAGCATGGACTGGACGCAGGATAGTTACAAAAGGACAAAGATAGGCCATGGAGACATCTTTCTGAGAACCACCGACTGTACAGTCTACTTCTGTGATGAGAGGGAGAAAGCACACTCGAGGCTGACAAGAAGGGTGCTAAGCCGATATCCAGAAGTGACTAAGAGCGAGAAAATGGCATGCGCAGGAGGAGCATACGTGACGGTGGAACGAGAAACCACCATCAAAACAAAAGAGGGGAGACAGACAGACAAAACGAGTGCTGTGATCATGTTCCATGATGCGACCAAACAGGACGGCCGAAGTCAAAAGGACATGTATGAGCTCCTGTCCGAATTAACCAAAATAGTGGAAGAGATGGGAAACAAAGAGCTGACTATTATAAAGCCCCAAGGAATCGATACAGGTGTAATAAGAAAGATGTTAGAAGTACTGTTCCGTGGAAAGGACATCGAATTAGAATTAAGGACACCTAAAAAAGGAGAAAACACAAACAATACGGAAACAAGAAAACGGGACGAGGTAATAGTCATAGAAGGAGGGACAACTACTTATGCGGACACCGTAAAGAGGCTAAAAGAAGGAATAAAAGGGACCGCATCCCTAGAAAACATAAAAGGTGTAAAAAAGACAGCCAAGGGACAAGTACTGGTAAGAGTGATGGGAAATATTGAGGAGATGACTGGGAAAATAAGAGAAATGATGCGAGATAGAAAGGTAAGAAGAACTGGGGGGAGCAAGAAAAAAGTATTACACATAAAAGGAATGGACAGCTCGGTGGAAATGGAGGAAGTAAGGGAGGACTTAAAGTCGACAAACTTGATAAAAGAGTGGGACCACTTGGAGATAAGATCATTGAGACCGATGGGCGGTGGAAACCAGACGGCAACAGTGATCCTGGATGAAGAGGATGCAGGAAGGCTGCTTGCGGGTGGTAAGCCTATAAAAAAAATGGTTTTTAAAGTGTTACAGATAAATATAGACCGAGGGAAAGCCGCGCACGACCTACTTCTGGCAACTGCGAGCAGTATGAACGCGGATCTTGTAATGCTATCTGAACCCAATAGAAAATTGGCTAAAGCTGCTGGATGGGAGTGTGACACCAGGGGAGATGCAGCCCTAGTGATTCTTAATAAAACACTGACGGTTTCTGAAATTTATAGGGGGAAGGGATTTATTGGATTCAAAATGAAGGACTTTGCCGCGTTCAGCTGTTATATATCTCCAAACTGCAGTTTCGAGGAGTTCAAAGCAGACGTCGATGAGCTTTGGACACTACTTAAAAAACAAAAGACACCGATCCTAGTGGCAGGAGATTTTAACTCTGCATCGAGAGCGTGGGGCAGTAAAGCAACCAACAAAAGGGGCCACTACCTGCTGGAAATGGTGGCGGACCTTGACACTGTCATCATGAATGAAGGCGTGACCCCAACTTTTGAAAGAGGAGACAGAACATCTAGGCCCGACATCACCATGGCCTCTGAAACGCTGGCAGGCAAGATTAGTAATTGGCAAGTGCGCGACGAGGAGACAATGAGCGGACATAAATATATAGCCTACGAGATAAAGCATGTATTGCCTCTATCCCAGTGCCATGCACAGATGAAAAGGTGGAACCTCCAAAGGCTGGACGTAGATAAGTTCAGTAGAAGCCTGAAAGGAGCGCAGATCTCGACTCCCATGGAACTGGTGCAGGCTACGACGGCAGCGTGTGACGCTTCTATGCCAAAGCAAAACAACCGCAAGAAGAAAGGAGTCTACTGGTGGAACAAGGAAATTGCGGAAGCAAGGAAGGAGTGTTTGAAATGCCGAAGGAGGTACACAAGGAATAACAAAAAGCTAGGAAAAGGGAAAGACAGGGAAAGTAACAAAGAAAATGAACACAAAAAGCAGTATAAGGAAGCGAAACTGGAGCTACAAAGACGAATATGGAAAGCGAAAGACGATAAATGGAGGGAAGTGTGCGAGGAAGTCGACAATGATATATGGGGACTGGGATACAAAATAGTGTCAAAAAAGCTACGCGGAAACTCACCAATAAATATGGGCATGGCCCAAATTCAAAGCATAGCTGATGGCCTCTTCCCGGAACACATAGATTTCGAACGGAAAACGAAACCGTCACAGGAGTTCCCAGAGGTGACCGAGGAGGAGATCATCCAACTAAAAGCTCGCATAAAGCTCAGGAAAGCCCCAGGGCCCGATCGGATTCCGCCGGAGATAGTGACTCTAGCAGTAGCAGTAATTCCAGACAAGATAAGGCTTGTGTTGCAGAAGGTGCTGGAGTCTGGCGTCTTCCCCAACAGCTGGAAAACAGCCAGACTAGTCCTGCTAAAAAAACCAGGCAAACCCGCTGAAGATCCTGCGGGGCACAGGCCGCTATGTCTACTGGACTGCTACGGAAAGCTGCTGGAGTCACTGATCCTAGGCAGAATAGAAAAACAACTAGTGCAATCGGACTGTTTACAAGATTCACAGTACGGGTTCAGAAAGGGGAGGTCCACAGTGGATGCAGCCAACAAGCTACTTGAGATAGCGGAAGACGCGAGACGAGGAACCCACCGCACCAGAAGAATCTGCGCAGTAGTGGCCCTCGACGTCCGAAATGCTTTCAATTCTGCATCGTGGGAGCTCATCCTGGAGGAAATGGCTGCAATAGGTATGCCTCAATACATCTATAATATCATAAACAGCTACCTCCAGGACAGATGCATCATACTGACAGACGCCGAGGGAGGGGCTGTAGAGAAAAAGGTTACCGGTGGTGTTCCGCAGGGGTCGATACTGGGCCCCACGCTGTGGAACATACTCTATGATGGGGTACTGCGCCTCGAACTGGGGGACGGGGCAAAATTAATAGGCTTTGCTGACGATTTAGCCCTGGTGGTGTCAGCAAAGAAGGAAGCAGAACTGATGTCAATAACGAACGTAGCTCTAGAAAAGATCAGCGCTTGGATGAAGCAGAAGCGGCTACACTTGGCCCCAGAAAAGACCGAGGCAATTGTCTTAAGTGGGCGAAGGAAGCTGAGCGAGATCTGCTTTACCCTCCAGGGCGTCAGGGTGGTTCCAACCGACAAACTTAAATACCTTGGGTTGTGGTTTGACAAAAGTTTGAAGTTCGGTAAACACATTGAAGAAACAACGGGTAAAGCCGAAAGATTGACGGCCGCCCTTGGCCAAATTATGCCCAGAAAAGGAGGGCCGAGGTCAAGCAAGCGCAGACTATTGGCATCCGCGATACAATCTGTGATGTTATATGGAGCACCGGTGTGGGCAAGGGTAATGAATGTAGCGAAGTACAGGAACATGTATAGCAAAGTGCAACGACAGCTGGCAATACGCATCTGTGGAGCTTACCGTACCATATCGCTAGACGCCGTCTTGGTGATAGCGGGCCTGATACCGATAGAACGGCTAGCAAAGGAACGGCAACGCTACTACCACGAGGGGACAAGAACGAGAGAAGAGGAAAGAGCACATACAATAAAAGAATGGGAACGAGACTGGCAGAAGGAGGGAAAAGGAAGGTGGACTCGTACAATCATACCCAACCTTAGGCTCTGGATGGGACGGAAACATGGCGAAACCGACAGACTGCTGACACAGGCCCTAAGTGGGCATGGAGTTTTCAACACTTACCTGCATTCAATAGGGAAAGCAGAAAGCGCAAGTTGTTCATACTGCGAACATGTTGACACACCTGAACATGCCCTATTTCAATGCATAAAGTTTACAGAACTAAGAGAGAAAACGGAGGGAAGTGACGGAAAGGTGACTGTGGATAACCTGATGGTGAGAATGATCCATAGTAAAGAAGAATGGGATAAATATGCGGGAATGCTCAAAGAGATAATGAGAGTGCGGGAAAAGGACGAAAGACTAAGGCAAGAATCTATGTATAATAATCTATAA
Protein
MPAGGEPVPDVPPVRRSSVVHTTLRKLPKLETTQGREMEEEEQPVITAYSGENDYSDQGSIGESFEVSSVTILEKDWEQVEDPFKRRESIKRTPPGALKELKTPSKMADSGTLVQEDVFLTPKEKIAEVAENTPMRPKKRKKLSSPIVIQPVEAEPPVEYLKLKTKIDKLVKFGKENKNVHRQIKDLLIDLPGLMERVTIRYKDDTNKPTEMEQKFEAYKKEQEEKIRRLEQEIKELKTLHKRETGENQLFKLDDQMIDSYDDFSKVSSMDWTQDSYKRTKIGHGDIFLRTTDCTVYFCDEREKAHSRLTRRVLSRYPEVTKSEKMACAGGAYVTVERETTIKTKEGRQTDKTSAVIMFHDATKQDGRSQKDMYELLSELTKIVEEMGNKELTIIKPQGIDTGVIRKMLEVLFRGKDIELELRTPKKGENTNNTETRKRDEVIVIEGGTTTYADTVKRLKEGIKGTASLENIKGVKKTAKGQVLVRVMGNIEEMTGKIREMMRDRKVRRTGGSKKKVLHIKGMDSSVEMEEVREDLKSTNLIKEWDHLEIRSLRPMGGGNQTATVILDEEDAGRLLAGGKPIKKMVFKVLQINIDRGKAAHDLLLATASSMNADLVMLSEPNRKLAKAAGWECDTRGDAALVILNKTLTVSEIYRGKGFIGFKMKDFAAFSCYISPNCSFEEFKADVDELWTLLKKQKTPILVAGDFNSASRAWGSKATNKRGHYLLEMVADLDTVIMNEGVTPTFERGDRTSRPDITMASETLAGKISNWQVRDEETMSGHKYIAYEIKHVLPLSQCHAQMKRWNLQRLDVDKFSRSLKGAQISTPMELVQATTAACDASMPKQNNRKKKGVYWWNKEIAEARKECLKCRRRYTRNNKKLGKGKDRESNKENEHKKQYKEAKLELQRRIWKAKDDKWREVCEEVDNDIWGLGYKIVSKKLRGNSPINMGMAQIQSIADGLFPEHIDFERKTKPSQEFPEVTEEEIIQLKARIKLRKAPGPDRIPPEIVTLAVAVIPDKIRLVLQKVLESGVFPNSWKTARLVLLKKPGKPAEDPAGHRPLCLLDCYGKLLESLILGRIEKQLVQSDCLQDSQYGFRKGRSTVDAANKLLEIAEDARRGTHRTRRICAVVALDVRNAFNSASWELILEEMAAIGMPQYIYNIINSYLQDRCIILTDAEGGAVEKKVTGGVPQGSILGPTLWNILYDGVLRLELGDGAKLIGFADDLALVVSAKKEAELMSITNVALEKISAWMKQKRLHLAPEKTEAIVLSGRRKLSEICFTLQGVRVVPTDKLKYLGLWFDKSLKFGKHIEETTGKAERLTAALGQIMPRKGGPRSSKRRLLASAIQSVMLYGAPVWARVMNVAKYRNMYSKVQRQLAIRICGAYRTISLDAVLVIAGLIPIERLAKERQRYYHEGTRTREEERAHTIKEWERDWQKEGKGRWTRTIIPNLRLWMGRKHGETDRLLTQALSGHGVFNTYLHSIGKAESASCSYCEHVDTPEHALFQCIKFTELREKTEGSDGKVTVDNLMVRMIHSKEEWDKYAGMLKEIMRVREKDERLRQESMYNNL

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR000477   RT_dom        + More
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D
PDB
1WDU     E-value=1.59612e-10,     Score=164

Ontologies

Topology

Length:
1570
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
21.16503
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1570
 
 

Population Genetic Test Statistics

Pi
2.82618
Theta
19.0052
Tajima's D
-1.128568
CLR
0.00001
CSRT
0.112844357782111
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号