SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16634
Pre Gene Modal
BGIBMGA012735
Annotation
PREDICTED:_netrin_receptor_UNC5C-like_isoform_X2_[Bombyx_mori]
Full name
Netrin receptor unc-5      
Alternative Name
Unc5 netrin receptor
Location in the cell
Extracellular   Reliability : 3.287
 

Sequence

CDS
ATGAAAACCATTGATGGTCTTCCAATATTCTTATTAGAACCTAAAAACTCGTATGTCATTAGGAATAAACCAGCCACGATTCTCTGTAGGGCTGCCAATGCTCTTCAAGTGTTCTTCAAATGCAATGACGTGAGAACTGATAAGACAGTACAATACGAACACGTGGATCCTCAGAATGGAGTGAGGGTGGTCGAAGCAGAGCTAAATGTGACCAGAAATGAGTTAGATGAATATTTCGGTGGAAAATACGGGTGTGAGTGCTACGCTTGGAATAGTAAAGGGCGGATTCGCAGTCAGTCCATTTTCATCGAATACGCTTTCATCAAGAAGCATTTCGTGCAGCAACCGCAGTCAGCGACAGTCGAATCAGGCAAGAGCGTCACATTCCGATGTATTCCGCCACAAGCCACACCAGCTCCAAGTCTCAAATGGACAAGAAATGGAGTGCCTATTGAGGCAAAGGACGAAAATTTAGTGCTTCCTAATGTTGGGTTGCAGTGCAAAATATTAAGGTGTTATCACTTTGCGAATTCAATCACAGGACATGACAAACTACACTGTATAGCTGAGAACGTCGCCGGTCGGCGCGAGTCGAACGTGGCCGTGCTCTCTGTATACGTAAATGGAGGCTGGTCAGCCTGGTCTCCGTGGATGCCGTGTCGTTGCGGCTCCAGAATTAGCGGAAGACGTCGCACGAGAACTTGCACAGAGCCTCCGCCGGCCAACGGAGGAGCGCCCTGCAGAGGCCAGGCCTCGCAGAGCGACGAGGAATGCTTACGATGTCAGACCGGTAAGAGTGCGGGTACCAAGACACACTCTTCATGA
Protein
MKTIDGLPIFLLEPKNSYVIRNKPATILCRAANALQVFFKCNDVRTDKTVQYEHVDPQNGVRVVEAELNVTRNELDEYFGGKYGCECYAWNSKGRIRSQSIFIEYAFIKKHFVQQPQSATVESGKSVTFRCIPPQATPAPSLKWTRNGVPIEAKDENLVLPNVGLQCKILRCYHFANSITGHDKLHCIAENVAGRRESNVAVLSVYVNGGWSAWSPWMPCRCGSRISGRRRTRTCTEPPPANGGAPCRGQASQSDEECLRCQTGKSAGTKTHSS

Summary

Description
Receptor for netrin required for motor axon guidance. Mediates both short- and long-range axon motor repulsion in the developing nervous system upon ligand binding. Also involved in glial migration. While short-range repulsion requires both fra and unc-5, long-range repulsion only requires unc-5.
Similarity
Belongs to the serpin family.
Belongs to the unc-5 family.
Keywords
Complete proteome   Developmental protein   Disulfide bond   Glycoprotein   Immunoglobulin domain   Membrane   Phosphoprotein   Receptor   Reference proteome   Repeat   Signal   Transmembrane   Transmembrane helix  
Feature
chain  Netrin receptor unc-5
EMBL
BABH01034762    RSAL01000046    RVE50542.1    KQ460416    KPJ14924.1    KZ149907    + More
PZC78261.1    ODYU01001331    SOQ37368.1    NWSH01001320    PCG71708.1    JTDY01004517    KOB68059.1    AGBW02012596    OWR44739.1    KQ459324    KPJ01648.1    AGBW02012107    OWR45646.1    KPJ01644.1    ODYU01004464    SOQ44360.1    BABH01029133    NWSH01004342    PCG65211.1    KZ150134    PZC73003.1    PZC78254.1    NWSH01001062    PCG72846.1    PCG72847.1    AGBW02011206    OWR47055.1    KQ460874    KPJ11666.1    RSAL01000124    RVE46623.1    KQ459586    KPI98031.1    KQ434870    KZC09610.1    GBRD01002257    JAG63564.1    GDHC01018809    GDHC01013807    JAP99819.1    JAQ04822.1    GBHO01043896    JAF99707.1    GBYB01010240    JAG80007.1    KQ414585    KOC70552.1    GECZ01015815    JAS53954.1    GECZ01030599    JAS39170.1    GECU01030740    JAS76966.1    KQ977642    KYN01011.1    GECU01026636    JAS81070.1    GEZM01086422    JAV59460.1    GEDC01031076    JAS06222.1    KQ435727    KOX77995.1    GGMR01019327    MBY31946.1    KK852508    KDR22415.1    GEBQ01016935    JAT23042.1    KK114558    KFM62729.1    GEBQ01024488    JAT15489.1    GFXV01004337    MBW16142.1    GGMS01000443    MBY69646.1    ABLF02041018    GL441572    EFN64605.1    KOX77999.1    LBMM01002575    KMQ94639.1    KQ981979    KYN31539.1    KK107847    EZA47457.1    GL887491    EGI71006.1    QOIP01000005    RLU23185.1    KQ982585    KYQ54241.1    ADTU01018638    ADTU01018639    KYN01006.1    KQ976625    KYM78963.1    JH430009    KQ980295    KYN16881.1    GAMC01015247    JAB91308.1    GAMC01015248    JAB91307.1    ADTU01025884    ADTU01025885    KZC09608.1    LBMM01000010    KMR05368.1    KYQ54236.1    GEBQ01015437    JAT24540.1    EGI71002.1    GAKP01009178    GAKP01009177    GAKP01009176    JAC49774.1    KYN16887.1    KYM78959.1    GL732542    EFX81631.1    GBXI01007470    JAD06822.1    GDHF01025673    GDHF01021499    JAI26641.1    JAI30815.1    CH954179    EDV55918.1    CM000158    KRK00314.1    APCN01005836    EDW92090.1    CM002911    KMY93977.1    CM000362    EDX07201.1    KMY93976.1    GL761846    EFZ22743.1    AE013599    AHN56248.1    AF247762    AY058501    KQ414755    KOC61811.1    RLU23184.1    CH480816    EDW47979.1    EZA47459.1    CH902619    EDV36586.1    KPU76313.1    AXCN02000665    CH933808    KRG04084.1    EDW08378.1   
Pfam
PF00090   TSP_1        + More
PF17217   UPA
PF00791   ZU5
PF00531   Death
PF07679   I-set
PF00079   Serpin
Interpro
IPR036383   TSP1_rpt_sf        + More
IPR000884   TSP1_rpt       
IPR037936   UNC5       
IPR036179   Ig-like_dom_sf       
IPR003598   Ig_sub2       
IPR013783   Ig-like_fold       
IPR007110   Ig-like_dom       
IPR003599   Ig_sub       
IPR011029   DEATH-like_dom_sf       
IPR000906   ZU5_dom       
IPR000488   Death_domain       
IPR033772   UPA       
IPR013098   Ig_I-set       
IPR042178   Serpin_sf_1       
IPR042185   Serpin_sf_2       
IPR023796   Serpin_dom       
IPR036186   Serpin_sf       
SUPFAM
SSF48726   SSF48726        + More
SSF82895   SSF82895       
SSF47986   SSF47986       
SSF56574   SSF56574       
PDB
4V2A     E-value=3.33782e-35,     Score=370

Ontologies

Topology

Subcellular location
Membrane  
Length:
274
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0175
Exp number, first 60 AAs:
0.00036
Total prob of N-in:
0.01132
outside
1  -  274
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号