SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16622
Annotation
non-LTR_retrotransposon_R1Bmks_ORF2_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 0.992
 

Sequence

CDS
ATGAGTGCCAAAGGCCGGAGGACCGGCCTGCATATCCCGGTTGCTTCTGGACTGTCGTCCTCGGCGCCTGTCACCCCGGTTGACCCAGTGGCTGGTGTCCCTAGCTTCCCCATTCCTGTTGCGTCGGGGGCTCCGACTGGACCCCTTGATGTAGCAGCGCAGGGGAGGCTGGAGCTGCTCGAGCGGGCAAACCGAGCGGTGCGCGGGATCATGTCGGTGGCGACGGCGGCATCTAAGCTCAATAAGTCGGAGGTCAATCTAATCTCTGAACTCGGTCGCGATATCCTGGCCGTAGTTGGGGCCCTCGGGATCCAGCTCTCTGATAAGGAGCTGGTGGTCGAAAGGCTCCGCTCGGCAGAGGCCTCTGCACGGCGTGACTCCGTGGCGCCTTCGATGGCTGCTGGTGCGGCGGCCGGGTCTGGGACTGGGCCTGCGACCTTCGCCACTGTCCTCAGGACGGGCCCTGGTGGGGTCCCGAGGTCCATTGGGGCCTCTCAGGGGCCTTCCTTGGCATTCTACCCGTCCGAGGGCAATGCGGAACTGAAGACAGCTGAGGACACAAAGAAAGAGGTAAAAAAGGCCATTGACCCTAAGTCAATGGCTATTGGAATACAGAGCGTAAGGAAGGTTGGGAATGCGGGGGTAGTGGTGCAGACCACGTCCCCCGCGGCCGCAGTCAAGCTTAGAAATGCTGCCCCGCCATCACTGAGAGTCACCGAACCCAGGCGCCGACAGCCCTTAGTAGCTGTCAATGGCGTGGAGGGCGACCCCTCCTTCGAGGAGGTAATCGAGTGCCTGGCTAGCCAGAACCTCGACCCGGAGGAGTGGCCCCTCACTAGGGTACGAGCGGAGCTCACGGGGGCGTTCAAAAAGGGGAGGCGACAATCCAACAACACTACTGTGGTGTTTAACGCCTCCCCTCGCATCAGGGACGCCCTCGTGAAGATTGGCAGAGTGTATGTGGGGTGGGTCGCCTGTGAGGTCACGGACTTTGTCCGGGTGACCTGCTGCAATAAGTGTCAGCAATATGGTCACCCGGAGAAATTTTGCCGGGCCAAGGAGGCCACCTGTGGCCGATGTGGAGAGGATGGCCACCGAATGGAGGCCTGTAAGGCAGCCTCCGCGTCGAGTATGGATATTAGGCCCCGACTTCGTATTGGCCAAATCAATCTGGGTGGTGCAGAGGATGCGACGAGGGAGCTACCCTCCATTGCACGGGATCTCGGCCTGGATATTGTTCTTGTACAGGAACAATATTCCATGGTCGGGTTCCTAGCCCAATGTGGAGCACACCCCAAGGCGGGTGTGTATATCCGCAATAGGGTGCTCCCCTGCGCGGTTCTGCACCACCTTAGCAGCACACATATAACGGTAGTGCACATTGGGGGGTGGGACTTATATATGGTGTCTGCGTACTTCCAGTATAGTGACCCTATTGACCCATACCTGCACCGGCTCGGGAATATTCTTGACCGGCTGCGGGGGGCTCGGGTCGTTATCTGCGCAGACACTAATGCCCACTCGCCATTGTGGCACTCGCTGCCCAGGCACTACGTCGGTCGGGGTCAGGAAGTGGCTGACCGCCGCGCCAAGATGGAGGATTTCATTGGGGCGAGGCGGTTGGTCGTCCATAACGCGGATGGCCACCTGCCGACCTTCAGTACGGCGAACGGAGAATCTTATGTCGATGTCACGCTGTCTACGCGGGGAGTACGCGTGTCTGAATGGCGTGTAACTAATGAATCATCGAGCGATCACCGGCTCATTGTGTTTGGGGTGGGGGGCGGTACAACAGGGGAGCGGGACGAGGACGAGGAGGCGCGGAGCGATTTGAGGCCGGGCGAGCCGTGCGCACTGCGTCGGTACCGGGACCGTGGGGTGGATTGGGACCTCTTCAGATCGCGTATCCACGAGCGAATGGGGAGTCTGGACCTCGAGGAACCTGTGGCTGCCCTTTGCGAAAAATTTACCGGGGTTATAACTCGCACAGCTGAAGAATGCTTAGGATCACTGAAAGCAGATAGAACTGACAGGGGTTATGAGTGGTGGACCCCAGTACTCGATAAGCTTAGGGTAGCCCAGGGTAGGGCCAGGCGTCGATGGCAAAAGGCCCGCCGAACGGGGGGTGAGGAAGAGGAGCAGTCTGGGAGAGTCTTCCGCGACCGCAGGCGCGAGTATCGAAGAGCGATGCATGACGCTGAGACCGCCTTTTACCGGGAGATCGCTGAAGGGGGAAACCGTGACCCGTGGGGACTAGCGTATCGGACGGCGAGTGGTAGGCGACGCGCACCAACTAATGTGGTTAACGGGGTGGAGTATGCGGGGCGGTGCTCGGATGATGTGAGTGGGGCCATGCGCACCTTGATGTGGGCGCTGTGTCCGGATGACTATATGTCTCGGGACACTCCGTACCATGCGCGGGTGCGTATCATGGCCGCGCTCCCCCCATCCGGGCGGGACGCAGACCCGCTGAGCAAAGACTCCCTTCGTGCCATAATTGGCTCACTGAAGAATACCGCACCGGGCATCGACGGTTTAACGGCGCGCATTATCAAAAAGGCACTTCCGGCTGCTGAGGCCGAGTTCGTGGCCGTATACGCACGGTGCGTTGTGGAGGGGACCTTCCCGCCGGTGTGGAAGGATGGCCGCCTACTTGTTCTGCCAAAGGGGAATGGCAGGCCCTTAACGGACCCTAAGGCGTATCGCCCGGTCACCTTGCTGCCGGTCCTGGGAAAGATCTTGGAGAAGGTATTATTGCAGTGTGCTCCTGGCCTCACCCATAGTATTAGTCCGCGCCAGCACGGGTTCTCTCCTGGACGCTCAACGGTGACGGCGCTGCGAACTCTGCTGGACGTGTCGCGCGCCTCGGAGCAGAGGTACGTAATGGCCATATTCTTGGACATCAGTGGAGCTTTCGATAACGCGTGGTGGCCCATGATAATGGTGAAGGCCAAGCGGAACTGTCCGCCCAACATCTATCGGATGCTGACGGACTATTTCCGCGGACGCCGTATTGCCGTTGTCGCGGGGGAATGTGCGGAATGGAAGGTGTCCACGATGGGCTGTCCGCAGGGCTCAGTGCTCGGGCCGACGCTCTGGAACGTTCTGATGGATGACCTGCTCGCCTTGCCGCAGGGGATAGAGGGAACAGAGATGGTCGCCTATGCCGATGACGTGACGGTACTGGTTAGGGGTGACTCACGGGCGCAGCTTGAGAGGAGAGCGCACGCCGTGCTAGGACTCGCAGAGGGGTGGGCGAGCAGGAATAAGCTCGATTTTGCCCCGGCGAAGTCCCGATGCATAATGCTGAGGGGAAAGTTTCAGCGTCCCCCTATAGTCCGGTACGGCAGTCATGTCATTCGGTTCGAGAACCAGGTGACGGTGTTGGGCGTCGTCTTCGACGATTGCCTCTCTTTCGCGCCGCATGCGGCGGCCATTGGCGAGAGGGCGAGCAGGTGCTTCGGCAAGATGTCTAGAGTTTCGGCTTCGGCTTGGGGGCTGCGATATAGGGCTTTGCGTGTCTTGTACATGGGCACTTATGTTACAACCCTTACCTATGCGGCGGCCGTATGGTATTTGCGGGCTGCTGTGCACGTCGTGCGCAGCGTGCTGCTTAGGACGCAGCGCCCGTCGTTGACGCTGCTAACGAAGGCCTACCGTTCGTGCAGCACGGCTGCTTTGCCGGTGTTGGCGGGCGTCCTGCCGGCGGACCTGGAGGTGACTCGTGCTGGACGGAGGATGCGGGAGTGCGAAGGATTGGCGCGGGAGTTGGCGGCGGAGAGACGACGACGGATCGACGGCGATGTCTTGGTAGTTTGGCAGAACAGGTGGGTGTCTGAGGGTAAGGGGAGGGAACTGTACAAGTTCTTTCCCGATGTTGCGGACAGGAAGAAGGCAACGTGGATGGAGCCGGACTATCAGACCTCGCAGATCCTCACGGGTCATGGGATCTTTAATAAGCGGTTGGCGGATATGCGACTGAGGGAGGGGCATGCTTGCGACTGCGGGGCGGTTGAGGAGGATAGGGACCATGTCCTGTGGGAGTGTCCTCTCTATGACGAAATCCGGGGCAGGATGCTCGATGGAATCTCGCGGTCTGAGGTGGGCCCAGTTTACCACGCGGACCTGGTCAGGGACGAGAAAAATTTTCGGCTCTTGCGCGAGTTCGCGCATACATGGCACACGGCGCGCACTGCGCGCGAATCACGAGGACTGCCTGGCGACGAAGAATGTGGGTGA
Protein
MSAKGRRTGLHIPVASGLSSSAPVTPVDPVAGVPSFPIPVASGAPTGPLDVAAQGRLELLERANRAVRGIMSVATAASKLNKSEVNLISELGRDILAVVGALGIQLSDKELVVERLRSAEASARRDSVAPSMAAGAAAGSGTGPATFATVLRTGPGGVPRSIGASQGPSLAFYPSEGNAELKTAEDTKKEVKKAIDPKSMAIGIQSVRKVGNAGVVVQTTSPAAAVKLRNAAPPSLRVTEPRRRQPLVAVNGVEGDPSFEEVIECLASQNLDPEEWPLTRVRAELTGAFKKGRRQSNNTTVVFNASPRIRDALVKIGRVYVGWVACEVTDFVRVTCCNKCQQYGHPEKFCRAKEATCGRCGEDGHRMEACKAASASSMDIRPRLRIGQINLGGAEDATRELPSIARDLGLDIVLVQEQYSMVGFLAQCGAHPKAGVYIRNRVLPCAVLHHLSSTHITVVHIGGWDLYMVSAYFQYSDPIDPYLHRLGNILDRLRGARVVICADTNAHSPLWHSLPRHYVGRGQEVADRRAKMEDFIGARRLVVHNADGHLPTFSTANGESYVDVTLSTRGVRVSEWRVTNESSSDHRLIVFGVGGGTTGERDEDEEARSDLRPGEPCALRRYRDRGVDWDLFRSRIHERMGSLDLEEPVAALCEKFTGVITRTAEECLGSLKADRTDRGYEWWTPVLDKLRVAQGRARRRWQKARRTGGEEEEQSGRVFRDRRREYRRAMHDAETAFYREIAEGGNRDPWGLAYRTASGRRRAPTNVVNGVEYAGRCSDDVSGAMRTLMWALCPDDYMSRDTPYHARVRIMAALPPSGRDADPLSKDSLRAIIGSLKNTAPGIDGLTARIIKKALPAAEAEFVAVYARCVVEGTFPPVWKDGRLLVLPKGNGRPLTDPKAYRPVTLLPVLGKILEKVLLQCAPGLTHSISPRQHGFSPGRSTVTALRTLLDVSRASEQRYVMAIFLDISGAFDNAWWPMIMVKAKRNCPPNIYRMLTDYFRGRRIAVVAGECAEWKVSTMGCPQGSVLGPTLWNVLMDDLLALPQGIEGTEMVAYADDVTVLVRGDSRAQLERRAHAVLGLAEGWASRNKLDFAPAKSRCIMLRGKFQRPPIVRYGSHVIRFENQVTVLGVVFDDCLSFAPHAAAIGERASRCFGKMSRVSASAWGLRYRALRVLYMGTYVTTLTYAAAVWYLRAAVHVVRSVLLRTQRPSLTLLTKAYRSCSTAALPVLAGVLPADLEVTRAGRRMRECEGLARELAAERRRRIDGDVLVVWQNRWVSEGKGRELYKFFPDVADRKKATWMEPDYQTSQILTGHGIFNKRLADMRLREGHACDCGAVEEDRDHVLWECPLYDEIRGRMLDGISRSEVGPVYHADLVRDEKNFRLLREFAHTWHTARTARESRGLPGDEECG

Summary

EMBL
AB182560    BAD82946.1    M19755    AAC13649.1    GEDC01008950    JAS28348.1    + More
GEDC01005462    JAS31836.1    GBBI01004973    JAC13739.1    AAZX01008070    LBMM01003366    KMQ93606.1    ABLF02007471    ABLF02007472    GFTR01008452    JAW07974.1    ABLF02008888    ABLF02016960    ABLF02032572    AAZX01006426    ABLF02027069    ABLF02027071    ABLF02010919    ABLF02010923    ABLF02010931    ABLF02007045    ABLF02039177    ABLF02016436    ABLF02012872    ABLF02012873    ABLF02012874    ABLF02012875    ABLF02042485    ABLF02010037    ABLF02010039    ABLF02066755    ABLF02019936    ABLF02057951    GFTR01008469    JAW07957.1    ABLF02006133    ABLF02012458    ABLF02012459    ABLF02012124    ABLF02008516    ABLF02041501    KK119855    KFM76920.1    ABLF02020044    ABLF02004512    ABLF02004513    ABLF02046624    ABLF02049075    ABLF02059998    ABLF02065990    AB046668    BAB21511.1    ABLF02004773    ABLF02020082    ABLF02020086    ABLF02020092    ABLF02022279    ABLF02034348    ABLF02008515    ABLF02013103    ABLF02013105    ABLF02013107    ABLF02061460    ABLF02041886    KU543682    AMS38369.1    ABLF02007851    ABLF02016357    ABLF02064424    AB090812    BAC57900.1    LBMM01010435    KMQ87461.1    ABLF02009073    ABLF02030702    ABLF02042963    GGFL01004044    MBW68222.1    GDHF01029467    GDHF01011533    JAI22847.1    JAI40781.1    GGMR01006838    MBY19457.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF00004   AAA
PF17862   AAA_lid_3
PF16725   Nucleolin_bd
PF05225   HTH_psq
PF05585   DUF1758
PF03564   DUF1759
PF00075   RNase_H
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR003959   ATPase_AAA_core       
IPR027417   P-loop_NTPase       
IPR003960   ATPase_AAA_CS       
IPR031996   NVL2_nucleolin-bd       
IPR041569   AAA_lid_3       
IPR003593   AAA+_ATPase       
IPR038100   NLV2_N_sf       
IPR007889   HTH_Psq       
IPR005312   DUF1759       
IPR008737   Peptidase_asp_put       
IPR036397   RNaseH_sf       
IPR002156   RNaseH_domain       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF52540   SSF52540       
SSF53098   SSF53098       
Gene 3D
PDB
2EI9     E-value=2.28684e-127,     Score=1172

Ontologies

Topology

Length:
1412
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
13.67875
Exp number, first 60 AAs:
0.01321
Total prob of N-in:
0.00705
outside
1  -  1412
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号