SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16619
Pre Gene Modal
BGIBMGA012647
Annotation
PREDICTED:_lipase_1-like_[Bombyx_mori]
Full name
Lipase      
Location in the cell
PlasmaMembrane   Reliability : 3.884
 

Sequence

CDS
ATGTCGTCGTTCAAAACATTAAAATTAATAAGTGCTCTCGTATTCTTAACATTTAAGCGCGGTGTAGCCACGGAAGACTCGTCCGGGACCGTGGCAAGCTTTTCATCAATAGCTGAAACTCTCGGATACGATTGCGTTGCTCACAGGATCACAACAAAAGACGGTTACATACTCACCCTGTTCAATATACCGGGCAACAAAACCAGGCCGATTTTTTTTATGCACGGATTCGGGGATTCCTCACGCACGTTCATAGTCCGAGGGAACACATCTATGTTGGTATCCGTGGCCAAAGCCGGGTATGACGTGTGGGCCGGGAACATGAGGGGGAATGAATACTCCCGCGACCACGTGACGCTAAACGCAGATATAGACGTCGCGGCCTACTGGAATTTTTCGTACCACGAAGTCGGCGTGTACGATCTGCCCGCCCAAATCGATTACATACTGAACAAGACCCAACAAAATCGACTGAGTGTCATAAGTCATTCCCAAGGAAGCGCCGTATTCTTCGTGCTCTTATCCACTTACCCCGAGTACAATGAAAAGATTCGACCCCTAATAACACTAGGGCCTTTATCATACGCTCAAAATATACGACCTCCAGTTAGATTATTGATTCTAATCGCGCCCGTTTTAGAGGTAATATTCAAGGCATTAAACCAGTACGAGCTGTTTGATAGAACGACGAGACTCATCGTAGAATTGCTTTGCAGTCTCCGACCGTTCGGTAGTGAATTGTGCGAAGCCATACTGCTGAGCACGGCGGGACAAAGCGACGACACGTTCAAAGGAGGATTCGTTCGCACGGTCATAAATTATTACCCGGTGAGCACTTCAGTTAAGAACAGCCTGCACGTTGCCCAAAACAGTAACAGCAGGAGGTTCGCCCAATACGATTACGGTCCGCGGCGAACATCGCTAGATACGGCAACGCTCTTCCACCGGCTTACGATCTGGACAAAGTGA
Protein
MSSFKTLKLISALVFLTFKRGVATEDSSGTVASFSSIAETLGYDCVAHRITTKDGYILTLFNIPGNKTRPIFFMHGFGDSSRTFIVRGNTSMLVSVAKAGYDVWAGNMRGNEYSRDHVTLNADIDVAAYWNFSYHEVGVYDLPAQIDYILNKTQQNRLSVISHSQGSAVFFVLLSTYPEYNEKIRPLITLGPLSYAQNIRPPVRLLILIAPVLEVIFKALNQYELFDRTTRLIVELLCSLRPFGSELCEAILLSTAGQSDDTFKGGFVRTVINYYPVSTSVKNSLHVAQNSNSRRFAQYDYGPRRTSLDTATLFHRLTIWTK

Summary

Similarity
Belongs to the AB hydrolase superfamily. Lipase family.
Feature
chain  Lipase
EMBL
BABH01038896    KQ460480    KPJ14361.1    KQ459580    KPI99336.1    BABH01034815    + More
BABH01043411    JTDY01008561    JTDY01003454    KOB64514.1    KOB69530.1    BABH01038893    BABH01038894    GDQN01001224    JAT89830.1    JTDY01007194    KOB65389.1    AGBW02010690    OWR48036.1    KQ461196    KPJ06301.1    BABH01032763    BABH01032765    KZ150080    PZC73881.1    AK403268    BAM19670.1    ODYU01002476    SOQ40012.1    AGBW02008642    OWR52889.1    KPI99333.1    BABH01038949    JTDY01002846    KOB70611.1    NEVH01009768    PNF32787.1    KQ971338    EFA02315.1    JXUM01107700    KQ565165    KXJ71265.1    OWR48034.1    LJIJ01000666    ODM95481.1    GL445305    EFN89852.1    NWSH01002215    PCG68894.1    JTDY01001637    KOB73274.1    ADMH02002130    ETN58533.1    KK852794    KDR16427.1    NNAY01001790    OXU22918.1    KQ460949    KPJ10406.1    GDHF01022533    JAI29781.1    CH478517    EAT32843.1    GAIX01002709    JAA89851.1    NWSH01002126    PCG69082.1    NWSH01000119    PCG79374.1    GEDC01029317    GEDC01024313    GEDC01024096    GEDC01020251    JAS07981.1    JAS12985.1    JAS13202.1    JAS17047.1    CH477866    EAT35487.1    KK852827    KDR15390.1    GEZM01023396    JAV88411.1    CCAG010008921    GALX01003535    JAB64931.1    DS231848    EDS36642.1    ODYU01012460    SOQ58781.1    NEVH01020850    PNF21255.1    KZ149971    PZC76037.1    KQ459598    KPI94527.1    JXJN01010151    JXJN01010152    JXJN01010153    JXJN01010154    CH940649    EDW64184.1    KRF81481.1    EAT35491.1    ADMH02001587    ETN61958.1    CH916368    EDW03599.1    GEZM01086956    JAV58943.1    CP012523    ALC38102.1    CH479189    EDW25486.1    LNIX01000009    OXA50396.1    JRES01001173    KNC24792.1    AAAB01008820    EAA05393.4    CH379061    EAL33110.2    GL887707    EGI70293.1    GECU01030185    JAS77521.1    KQ981523    KYN40355.1    CH933807    EDW12722.1    CH963857    EDW76544.2    CH902620    EDV32387.1    OUUW01000006    SPP81772.1    GANO01002781    JAB57090.1    AXCN02000090    APCN01002227    AE014134    BT003518    AAF52985.2    AAO39522.1    LJIJ01000475    ODM97066.1    CH480818    EDW52477.1    CH954177    EDV59003.1    CM000361    CM002910    EDX04580.1    KMY89593.1    GECZ01012738    JAS57031.1    EAT32845.1    CM000157    EDW87967.1    AGBW02011015    OWR47367.1    AK417362    BAN20577.1    KQ982580    KYQ54457.1    KZ150291    PZC71579.1    KQ976755    KYN08589.1    EDW76549.2   
Pfam
PF00561   Abhydrolase_1        + More
PF04083   Abhydro_lipase
PF12146   Hydrolase_4
Interpro
IPR029058   AB_hydrolase        + More
IPR025483   Lipase_euk       
IPR000073   AB_hydrolase_1       
IPR006693   AB_hydrolase_lipase       
IPR022742   Hydrolase_4       
SUPFAM
SSF53474   SSF53474       
Gene 3D
PDB
1K8Q     E-value=8.42665e-32,     Score=341

Ontologies

Topology

SignalP
Position:   1 - 23,         Likelihood:  0.890765
 
 
Length:
322
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.33792
Exp number, first 60 AAs:
0.01473
Total prob of N-in:
0.01957
outside
1  -  322
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号